Transcript: Mouse NM_001164769.1

Mus musculus F-box and WD-40 domain protein 2 (Fbxw2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Fbxw2 (30050)
Length:
2294
CDS:
194..1273

Additional Resources:

NCBI RefSeq record:
NM_001164769.1
NBCI Gene record:
Fbxw2 (30050)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164769.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012814 CCTCTTCGTTAATTGGACATA pLKO.1 615 CDS 100% 4.950 3.465 N Fbxw2 n/a
2 TRCN0000345045 CCTCTTCGTTAATTGGACATA pLKO_005 615 CDS 100% 4.950 3.465 N Fbxw2 n/a
3 TRCN0000012815 CCTGGAGACTACATCCTCTTA pLKO.1 1055 CDS 100% 4.950 3.465 N Fbxw2 n/a
4 TRCN0000353103 CCTGGAGACTACATCCTCTTA pLKO_005 1055 CDS 100% 4.950 3.465 N Fbxw2 n/a
5 TRCN0000012817 CTGGTCTCTAAGCAGTGGAAT pLKO.1 437 CDS 100% 4.950 3.465 N Fbxw2 n/a
6 TRCN0000345044 CTGGTCTCTAAGCAGTGGAAT pLKO_005 437 CDS 100% 4.950 3.465 N Fbxw2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164769.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02929 pDONR223 100% 76.1% 78.4% None (many diffs) n/a
2 ccsbBroad304_02929 pLX_304 0% 76.1% 78.4% V5 (many diffs) n/a
Download CSV