Transcript: Human NM_001165030.3

Homo sapiens transmembrane protein 41B (TMEM41B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TMEM41B (440026)
Length:
683
CDS:
153..536

Additional Resources:

NCBI RefSeq record:
NM_001165030.3
NBCI Gene record:
TMEM41B (440026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165030.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165030.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13686 pDONR223 100% 65.2% 64% None (many diffs) n/a
2 ccsbBroad304_13686 pLX_304 0% 65.2% 64% V5 (many diffs) n/a
3 TRCN0000476364 GATATCAAAAAACTAAAAACATCT pLX_317 60.1% 65.2% 64% V5 (many diffs) n/a
Download CSV