Transcript: Human NM_001165035.2

Homo sapiens fibulin 2 (FBLN2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
FBLN2 (2199)
Length:
4563
CDS:
383..4078

Additional Resources:

NCBI RefSeq record:
NM_001165035.2
NBCI Gene record:
FBLN2 (2199)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165035.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055805 GCCAGCACCTTTGCATCAATA pLKO.1 2229 CDS 100% 13.200 9.240 N FBLN2 n/a
2 TRCN0000443002 AGCGCTGTGAAGACGTGAATG pLKO_005 3339 CDS 100% 10.800 7.560 N FBLN2 n/a
3 TRCN0000055803 CCCAAAGTTGACATTCCATTT pLKO.1 4405 3UTR 100% 10.800 7.560 N FBLN2 n/a
4 TRCN0000438257 TGCGAGGGCTACCAGTACTAT pLKO_005 575 CDS 100% 5.625 3.938 N FBLN2 n/a
5 TRCN0000055806 GCCGATGGCTATATCCTCAAT pLKO.1 2639 CDS 100% 4.950 3.465 N FBLN2 n/a
6 TRCN0000055807 CCTGAACATCATCAAGGGCAA pLKO.1 3877 CDS 100% 2.160 1.512 N FBLN2 n/a
7 TRCN0000055804 GCCTGCACTGAAGTCAGAATT pLKO.1 2356 CDS 100% 0.000 0.000 N FBLN2 n/a
8 TRCN0000109476 GCCAACATCTATGGCTCCTAT pLKO.1 3392 CDS 100% 4.950 3.465 N Fbln2 n/a
9 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1218 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165035.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06195 pDONR223 100% 96% 96% None (many diffs) n/a
2 ccsbBroad304_06195 pLX_304 0% 96% 96% V5 (many diffs) n/a
3 TRCN0000476590 CTTAAAGGCGTAGCTGACAAACCG pLX_317 11.4% 96% 96% V5 (many diffs) n/a
Download CSV