Transcript: Human NM_001165038.2

Homo sapiens GDNF family receptor alpha 2 (GFRA2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GFRA2 (2675)
Length:
4676
CDS:
717..1796

Additional Resources:

NCBI RefSeq record:
NM_001165038.2
NBCI Gene record:
GFRA2 (2675)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060709 CCTGAATGACAACTGCAAGAA pLKO.1 908 CDS 100% 4.950 6.930 N GFRA2 n/a
2 TRCN0000060708 GCCAACAACTCCAAAGAGTTA pLKO.1 1635 CDS 100% 0.495 0.693 N GFRA2 n/a
3 TRCN0000060712 CAAAGAGTTAAGCATGTGCTT pLKO.1 1646 CDS 100% 2.640 2.112 N GFRA2 n/a
4 TRCN0000419596 GGGAACCGAGTCAGAATATTT pLKO_005 1802 3UTR 100% 15.000 10.500 N GFRA2 n/a
5 TRCN0000435223 AGGGCACGAGGCTCTAGAAAT pLKO_005 2046 3UTR 100% 13.200 9.240 N GFRA2 n/a
6 TRCN0000060710 GTTTGACATGACACCTAACTA pLKO.1 1307 CDS 100% 5.625 3.938 N GFRA2 n/a
7 TRCN0000060711 CTGTCTGTCCTGATGCTGAAA pLKO.1 1764 CDS 100% 4.950 3.465 N GFRA2 n/a
8 TRCN0000362557 TTCACAGAGCTCACGACAAAT pLKO_005 1665 CDS 100% 13.200 7.920 N Gfra2 n/a
9 TRCN0000079141 CTGGCATGATTGGGTTTGATA pLKO.1 1294 CDS 100% 5.625 3.938 N Gfra2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00631 pDONR223 100% 76.2% 76.2% None 39_40ins315;1063_1077del n/a
2 ccsbBroad304_00631 pLX_304 0% 76.2% 76.2% V5 39_40ins315;1063_1077del n/a
3 TRCN0000465990 CTTATAGGCCCCCTTGACCGTATG pLX_317 25.5% 76.2% 76.2% V5 39_40ins315;1063_1077del n/a
Download CSV