Transcript: Human NM_001165412.2

Homo sapiens nuclear factor kappa B subunit 1 (NFKB1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-29
Taxon:
Homo sapiens (human)
Gene:
NFKB1 (4790)
Length:
4052
CDS:
438..3344

Additional Resources:

NCBI RefSeq record:
NM_001165412.2
NBCI Gene record:
NFKB1 (4790)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006521 CGAATGACAGAGGCGTGTATA pLKO.1 903 CDS 100% 13.200 18.480 N NFKB1 n/a
2 TRCN0000277780 CGAATGACAGAGGCGTGTATA pLKO_005 903 CDS 100% 13.200 18.480 N NFKB1 n/a
3 TRCN0000006517 CGCCTGAATCATTCTCGATTT pLKO.1 3451 3UTR 100% 10.800 8.640 N NFKB1 n/a
4 TRCN0000277782 CGCCTGAATCATTCTCGATTT pLKO_005 3451 3UTR 100% 10.800 8.640 N NFKB1 n/a
5 TRCN0000006519 GCCTGAACAAATGTTTCATTT pLKO.1 467 CDS 100% 13.200 9.240 N NFKB1 n/a
6 TRCN0000277725 GCCTGAACAAATGTTTCATTT pLKO_005 467 CDS 100% 13.200 9.240 N NFKB1 n/a
7 TRCN0000006518 CCAGAGTTTACATCTGATGAT pLKO.1 2820 CDS 100% 4.950 3.465 N NFKB1 n/a
8 TRCN0000277724 CCAGAGTTTACATCTGATGAT pLKO_005 2820 CDS 100% 4.950 3.465 N NFKB1 n/a
9 TRCN0000006520 CCTTTCCTCTACTATCCTGAA pLKO.1 1473 CDS 100% 4.050 2.835 N NFKB1 n/a
10 TRCN0000277783 CCTTTCCTCTACTATCCTGAA pLKO_005 1473 CDS 100% 4.050 2.835 N NFKB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06637 pDONR223 100% 99.8% 99.8% None 115_116insCAG;1140T>C;2121G>A n/a
2 ccsbBroad304_06637 pLX_304 13.5% 87.4% 82.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV