Transcript: Human NM_001165903.2

Homo sapiens syntaxin 1A (STX1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
STX1A (6804)
Length:
2056
CDS:
39..794

Additional Resources:

NCBI RefSeq record:
NM_001165903.2
NBCI Gene record:
STX1A (6804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218716 AGAACTCATGTCCGACATAAA pLKO_005 266 CDS 100% 13.200 18.480 N STX1A n/a
2 TRCN0000230306 CAAGCCAGCGTTGCATGTTTG pLKO_005 1596 3UTR 100% 10.800 15.120 N STX1A n/a
3 TRCN0000257113 CAAAGTTCGTTCCAAGTTAAA pLKO_005 299 CDS 100% 13.200 9.240 N STX1A n/a
4 TRCN0000257133 AGGAGATTCGAGGCTTCATTG pLKO_005 151 CDS 100% 10.800 7.560 N STX1A n/a
5 TRCN0000065012 CATAAAGAAGACAGCAAACAA pLKO.1 281 CDS 100% 5.625 3.938 N STX1A n/a
6 TRCN0000065010 GAGGAGATTCGAGGCTTCATT pLKO.1 150 CDS 100% 5.625 3.938 N STX1A n/a
7 TRCN0000382305 ACTCCACGCTGTCCAGAAAGT pLKO_005 397 CDS 100% 4.950 3.465 N STX1A n/a
8 TRCN0000381347 CTCTGTGAGTGTGCGTCTGTA pLKO_005 1040 3UTR 100% 4.950 3.465 N STX1A n/a
9 TRCN0000381955 CTTTGCCTCTGGGATCATCAT pLKO_005 566 CDS 100% 4.950 3.465 N STX1A n/a
10 TRCN0000065008 GAAGAACTCATGTCCGACATA pLKO.1 264 CDS 100% 4.950 3.465 N STX1A n/a
11 TRCN0000381844 GGAGGTCATGTCGGAGTACAA pLKO_005 422 CDS 100% 4.950 3.465 N STX1A n/a
12 TRCN0000380705 TGAGTCTCAGTCGCTGATCAC pLKO_005 1350 3UTR 100% 4.050 2.835 N STX1A n/a
13 TRCN0000065009 CCAGAAAGTTTGTGGAGGTCA pLKO.1 409 CDS 100% 2.640 1.848 N STX1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07013 pDONR223 100% 87% 79.4% None 217G>A;676_677ins46;753_754ins65 n/a
2 ccsbBroad304_07013 pLX_304 0% 87% 79.4% V5 217G>A;676_677ins46;753_754ins65 n/a
3 TRCN0000481524 AGCCGTACAACCACTACAGACGTG pLX_317 60.1% 87% 79.4% V5 217G>A;676_677ins46;753_754ins65 n/a
Download CSV