Transcript: Human NM_001165946.1

Homo sapiens insulin degrading enzyme (IDE), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
IDE (3416)
Length:
4480
CDS:
326..1720

Additional Resources:

NCBI RefSeq record:
NM_001165946.1
NBCI Gene record:
IDE (3416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165946.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255816 ATAACTGTGGCATCGAGATAT pLKO_005 1020 CDS 100% 13.200 9.240 N IDE n/a
2 TRCN0000255817 TAGTTTCTGATTCACTATTAG pLKO_005 1803 3UTR 100% 13.200 9.240 N IDE n/a
3 TRCN0000000244 ATGGGAAAGTGCAAGTGGATG pLKO.1 1734 3UTR 100% 4.050 2.835 N IDE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165946.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00816 pDONR223 100% 45.5% 45.5% None 0_1ins1665 n/a
2 ccsbBroad304_00816 pLX_304 0% 45.5% 45.5% V5 0_1ins1665 n/a
3 TRCN0000471357 CATCCTTATAACGCTGTCCATTCA pLX_317 14.9% 45.5% 45.5% V5 0_1ins1665 n/a
Download CSV