Transcript: Mouse NM_001165995.1

Mus musculus ADP-ribosylation factor related protein 1 (Arfrp1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Arfrp1 (76688)
Length:
2483
CDS:
235..699

Additional Resources:

NCBI RefSeq record:
NM_001165995.1
NBCI Gene record:
Arfrp1 (76688)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001165995.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381048 ATGCCTAGGCCTGTTAGTTAG pLKO_005 1019 3UTR 100% 10.800 8.640 N Arfrp1 n/a
2 TRCN0000102741 CCATGGTGTCATCTATGTAAT pLKO.1 372 CDS 100% 13.200 9.240 N Arfrp1 n/a
3 TRCN0000102740 GCCTGGTTCAAAGTGGAATTT pLKO.1 1039 3UTR 100% 13.200 9.240 N Arfrp1 n/a
4 TRCN0000313286 ACCACTACCGTGGGTCTAAAC pLKO_005 253 CDS 100% 10.800 7.560 N Arfrp1 n/a
5 TRCN0000313287 CCTAGTGTTGGAAGAGTATTC pLKO_005 733 3UTR 100% 10.800 7.560 N Arfrp1 n/a
6 TRCN0000313349 CTTTGTGGGACAAGTACTATG pLKO_005 344 CDS 100% 10.800 7.560 N Arfrp1 n/a
7 TRCN0000382285 GCTTACCTCACTTGGAGAAAG pLKO_005 1160 3UTR 100% 10.800 7.560 N Arfrp1 n/a
8 TRCN0000102744 TCCTGACATCAAGACTGCATT pLKO.1 525 CDS 100% 4.950 3.465 N Arfrp1 n/a
9 TRCN0000102742 CCACTGATGAAGAAAGGCTGT pLKO.1 398 CDS 100% 2.160 1.512 N Arfrp1 n/a
10 TRCN0000312216 CCACTGATGAAGAAAGGCTGT pLKO_005 398 CDS 100% 2.160 1.512 N Arfrp1 n/a
11 TRCN0000047760 GCAGTCTTTGTGGGACAAGTA pLKO.1 339 CDS 100% 4.950 2.970 N ARFRP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165995.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07562 pDONR223 100% 66.8% 73.6% None (many diffs) n/a
2 ccsbBroad304_07562 pLX_304 0% 66.8% 73.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000476314 GAACCTTCATTTATCTTCGGGCAG pLX_317 46.5% 66.8% 73.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV