Transcript: Human NM_001166160.2

Homo sapiens protein phosphatase 1 regulatory subunit 9A (PPP1R9A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PPP1R9A (55607)
Length:
10547
CDS:
326..4450

Additional Resources:

NCBI RefSeq record:
NM_001166160.2
NBCI Gene record:
PPP1R9A (55607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337043 GGGTGAGATCCAGGTATAATT pLKO_005 1539 CDS 100% 15.000 21.000 N PPP1R9A n/a
2 TRCN0000336969 TACATGCACAGTGACTATAAT pLKO_005 1511 CDS 100% 15.000 21.000 N PPP1R9A n/a
3 TRCN0000052731 CCTTCAAACAAGCGAGGTGTT pLKO.1 1103 CDS 100% 4.050 5.670 N PPP1R9A n/a
4 TRCN0000337042 GATATGGAGTACTCGGAAATT pLKO_005 1631 CDS 100% 13.200 10.560 N PPP1R9A n/a
5 TRCN0000337093 TTAATGGAGCGCCGTGAATTT pLKO_005 4805 3UTR 100% 13.200 10.560 N PPP1R9A n/a
6 TRCN0000052728 GCCATCAAACAGTTTCTATAA pLKO.1 3148 CDS 100% 13.200 9.240 N PPP1R9A n/a
7 TRCN0000052729 CCCTTGAATTTACCATCTGTT pLKO.1 1028 CDS 100% 4.950 3.465 N PPP1R9A n/a
8 TRCN0000052732 CCTGAGACTCTAATTTCAGAT pLKO.1 3785 CDS 100% 4.950 3.465 N PPP1R9A n/a
9 TRCN0000052730 GCCACAGATGAAGAAGAAGAT pLKO.1 2294 CDS 100% 4.950 2.970 N PPP1R9A n/a
10 TRCN0000301005 GCCACAGATGAAGAAGAAGAT pLKO_005 2294 CDS 100% 4.950 2.970 N PPP1R9A n/a
11 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 8540 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.