Transcript: Human NM_001166301.2

Homo sapiens DEAH-box helicase 40 (DHX40), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
DHX40 (79665)
Length:
3344
CDS:
63..2171

Additional Resources:

NCBI RefSeq record:
NM_001166301.2
NBCI Gene record:
DHX40 (79665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051378 CGCAAGAATTGTATGCCCAAT pLKO.1 1871 CDS 100% 4.050 5.670 N DHX40 n/a
2 TRCN0000299549 CGCAAGAATTGTATGCCCAAT pLKO_005 1871 CDS 100% 4.050 5.670 N DHX40 n/a
3 TRCN0000051380 CCCAAGTTGCATGAATTTAAT pLKO.1 1920 CDS 100% 15.000 10.500 N DHX40 n/a
4 TRCN0000299613 CCCAAGTTGCATGAATTTAAT pLKO_005 1920 CDS 100% 15.000 10.500 N DHX40 n/a
5 TRCN0000051382 GAGACCTTTGAAGGCCCTAAA pLKO.1 1656 CDS 100% 10.800 6.480 N DHX40 n/a
6 TRCN0000299612 GAGACCTTTGAAGGCCCTAAA pLKO_005 1656 CDS 100% 10.800 6.480 N DHX40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04103 pDONR223 100% 90.1% 90.1% None 195_196ins231 n/a
2 ccsbBroad304_04103 pLX_304 0% 90.1% 90.1% V5 195_196ins231 n/a
3 TRCN0000471261 CTTACCCAGAGGAGATCAAATCAA pLX_317 13.6% 90.1% 90.1% V5 195_196ins231 n/a
Download CSV