Transcript: Mouse NM_001166409.2

Mus musculus RNA binding motif (RNP1, RRM) protein 3 (Rbm3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Rbm3 (19652)
Length:
1348
CDS:
259..723

Additional Resources:

NCBI RefSeq record:
NM_001166409.2
NBCI Gene record:
Rbm3 (19652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295192 AGTTACTCTAGAGGTGGTGGA pLKO_005 556 CDS 100% 2.160 1.512 N Rbm3 n/a
2 TRCN0000102443 CCGCTACTCAGGAGGAAATTA pLKO.1 681 CDS 100% 15.000 7.500 Y Rbm3 n/a
3 TRCN0000273461 CCGCTACTCAGGAGGAAATTA pLKO_005 681 CDS 100% 15.000 7.500 Y RBM3 n/a
4 TRCN0000287876 CCGCTACTCAGGAGGAAATTA pLKO_005 681 CDS 100% 15.000 7.500 Y Rbm3 n/a
5 TRCN0000102441 CCTATCTCTGAGGTGGTTGTT pLKO.1 349 CDS 100% 4.950 2.475 Y Rbm3 n/a
6 TRCN0000102442 GTCGTCCTGGAGGATATGGAT pLKO.1 608 CDS 100% 3.000 1.500 Y Rbm3 n/a
7 TRCN0000287877 GTCGTCCTGGAGGATATGGAT pLKO_005 608 CDS 100% 3.000 1.500 Y Rbm3 n/a
8 TRCN0000102444 CACTTGAAGACCACTTCAGCA pLKO.1 320 CDS 100% 0.264 0.132 Y Rbm3 n/a
9 TRCN0000287875 CACTTGAAGACCACTTCAGCA pLKO_005 320 CDS 100% 0.264 0.132 Y Rbm3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01381 pDONR223 100% 87.2% 94.9% None (many diffs) n/a
2 ccsbBroad304_01381 pLX_304 0% 87.2% 94.9% V5 (many diffs) n/a
3 TRCN0000468099 CTCTGACTTTCCCACCGTGGAATT pLX_317 54.9% 87.2% 94.9% V5 (many diffs) n/a
Download CSV