Transcript: Mouse NM_001166459.1

Mus musculus BRCA1/BRCA2-containing complex, subunit 3 (Brcc3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Brcc3 (210766)
Length:
1156
CDS:
92..967

Additional Resources:

NCBI RefSeq record:
NM_001166459.1
NBCI Gene record:
Brcc3 (210766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304718 GGAGTTGAATGATGACATAAG pLKO_005 211 CDS 100% 10.800 7.560 N Brcc3 n/a
2 TRCN0000222471 GCAGAAAGGTTGGCTGAACTA pLKO.1 401 CDS 100% 4.950 3.465 N Brcc3 n/a
3 TRCN0000222470 CCTCATATCACTATTGGGAAA pLKO.1 674 CDS 100% 4.050 2.835 N Brcc3 n/a
4 TRCN0000222469 GCTCAGTATTTACCAAGAATT pLKO.1 810 CDS 100% 0.000 0.000 N Brcc3 n/a
5 TRCN0000316069 GCTCAGTATTTACCAAGAATT pLKO_005 810 CDS 100% 0.000 0.000 N Brcc3 n/a
6 TRCN0000222468 CCCACCCTCATATAACTGTTT pLKO.1 459 CDS 100% 4.950 2.970 N Brcc3 n/a
7 TRCN0000316071 CCCACCCTCATATAACTGTTT pLKO_005 459 CDS 100% 4.950 2.970 N Brcc3 n/a
8 TRCN0000222472 CCGGGTACTCTATACTTGCTT pLKO.1 589 CDS 100% 3.000 1.800 N Brcc3 n/a
9 TRCN0000316070 CCGGGTACTCTATACTTGCTT pLKO_005 589 CDS 100% 3.000 1.800 N Brcc3 n/a
10 TRCN0000073971 CCAATCCATATTGTACCTCAT pLKO.1 659 CDS 100% 4.050 2.025 Y BRCC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04069 pDONR223 100% 84.3% 89.5% None (many diffs) n/a
2 ccsbBroad304_04069 pLX_304 0% 84.3% 89.5% V5 (many diffs) n/a
3 TRCN0000473706 CAAGATGCGAGAAACCGAATGAAA pLX_317 56.8% 84.3% 89.5% V5 (many diffs) n/a
Download CSV