Transcript: Human NM_001166664.2

Homo sapiens CD244 molecule (CD244), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CD244 (51744)
Length:
2219
CDS:
211..1032

Additional Resources:

NCBI RefSeq record:
NM_001166664.2
NBCI Gene record:
CD244 (51744)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166664.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057529 CGTCACAAGAACCTGCATATA pLKO.1 842 CDS 100% 13.200 10.560 N CD244 n/a
2 TRCN0000057528 GCAGCAATTCTCACCTTTCTT pLKO.1 1038 3UTR 100% 5.625 3.938 N CD244 n/a
3 TRCN0000057532 CCCTTCCTTCAATAGCACTAT pLKO.1 921 CDS 100% 4.950 3.465 N CD244 n/a
4 TRCN0000057530 CGTGATTCTAAGCGCACTGTT pLKO.1 621 CDS 100% 4.950 3.465 N CD244 n/a
5 TRCN0000057531 GCCTCTTCAGTTACAACCAAA pLKO.1 315 CDS 100% 4.950 3.465 N CD244 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166664.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03377 pDONR223 100% 74.7% 74.7% None 378_379ins276 n/a
2 ccsbBroad304_03377 pLX_304 0% 74.7% 74.7% V5 378_379ins276 n/a
3 TRCN0000481523 CCCATACCTCCCCAGTGTTGTTCG pLX_317 35.2% 74.7% 74.7% V5 378_379ins276 n/a
Download CSV