Transcript: Mouse NM_001166705.1

Mus musculus cilia and flagella associated protein 77 (Cfap77), mRNA.

Source:
NCBI, updated 2015-11-11
Taxon:
Mus musculus (mouse)
Gene:
Cfap77 (329375)
Length:
931
CDS:
59..874

Additional Resources:

NCBI RefSeq record:
NM_001166705.1
NBCI Gene record:
Cfap77 (329375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267161 TCGTGCGTGACTCCATGTTTC pLKO_005 213 CDS 100% 10.800 15.120 N Cfap77 n/a
2 TRCN0000283480 TACGGGCATGGAGAACGAAAG pLKO_005 184 CDS 100% 6.000 4.200 N Cfap77 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13662 pDONR223 100% 76.5% 70.7% None (many diffs) n/a
2 ccsbBroad304_13662 pLX_304 0% 76.5% 70.7% V5 (many diffs) n/a
3 ccsbBroadEn_14495 pDONR223 100% 76.3% 70.4% None (many diffs) n/a
4 ccsbBroad304_14495 pLX_304 0% 76.3% 70.4% V5 (many diffs) n/a
5 TRCN0000479918 ATTTTATCCCTTGATTGCTTAGGA pLX_317 38.6% 76.3% 70.4% V5 (many diffs) n/a
Download CSV