Construct: ORF TRCN0000479918
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009380.1_s317c1
- Derived from:
- ccsbBroadEn_14495
- DNA Barcode:
- ATTTTATCCCTTGATTGCTTAGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CFAP77 (389799)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479918
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 389799 | CFAP77 | cilia and flagella associat... | NM_001282957.2 | 99.7% | 99.6% | 4C>G;435T>C |
| 2 | human | 389799 | CFAP77 | cilia and flagella associat... | XM_011518670.2 | 89.9% | 82.8% | (many diffs) |
| 3 | human | 389799 | CFAP77 | cilia and flagella associat... | NM_207417.3 | 88.5% | 88.4% | 4C>G;194_301del;543T>C |
| 4 | human | 389799 | CFAP77 | cilia and flagella associat... | XM_011518671.1 | 67.2% | 60.8% | (many diffs) |
| 5 | human | 389799 | CFAP77 | cilia and flagella associat... | XM_017014711.1 | 61.9% | 61.2% | (many diffs) |
| 6 | mouse | 329375 | Cfap77 | cilia and flagella associat... | XM_006498132.2 | 83.8% | 87.3% | (many diffs) |
| 7 | mouse | 329375 | Cfap77 | cilia and flagella associat... | NM_001166705.1 | 76.3% | 70.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 921
- ORF length:
- 852
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcagaggcc aggagctccg gcccggacct cacgcgatgg aggaagcagc 121 agcagcctgt gcgccgcacg gtcagccagg tctgcccgcc cccgcggcgg cccctgaccg 181 tggcggacat ccgttccggc atggagaacg agcggctggg ggtcgtgcgg gactccatgt 241 ttcagaaccc tctcatcgtc aaggctgaac tcggcaagcc ccgggaaaga agctacagtc 301 tgcccggcat taattttaat tatggactct acatccgagg gcttgacgga ggagtccctg 361 aagccatcgg acgctggaac gtgttcaagc agcagcccac ctgcccccac gagctgaccc 421 ggaattatat cgcaatgaac cgcggggcgg tgaaagccgg cctggtgact gcccgggaga 481 acttgctcta ccgtcagctc aacgacatcc gcatcagtga ccaggatgac cggcgcatga 541 agaaagagcc gccccctctc cctccaaaca tgacatttgg gatccgggca cggCCTTCCA 601 CACCCTTCTT TGATCTGCTG CAGCACCGGT ACCTGCAGCT GTGGGTACAG GAACAAAAGG 661 CCACCCAGAA AGCCATCAAA CTGGAGAAGA AGCAGAAGGT GGTCCTTGGG AAGCTGTATG 721 AGACCCGGAG CAGTCAGCTG AGGAAGTACA AGCCGCCCGT GAAGCTGGAC ACCCTCTGGC 781 ACATGCCTCA CTTCCAGAAG GTGGGCCGCC ACCTTGATAC GTTCCCCACG GAGGCCGATC 841 GCCAGAGAGC ATTAAAAGCC CACCGGGAAG AGTGTGCCGT GCGCCAGGGG ACCCTGCGGA 901 TGGGCAACTA CACCCACCCC TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 961 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1021 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAATTT TATCCCTTGA 1081 TTGCTTAGGA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt