Transcript: Mouse NM_001167799.1

Mus musculus syntaxin 5A (Stx5a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Stx5a (56389)
Length:
1829
CDS:
172..1239

Additional Resources:

NCBI RefSeq record:
NM_001167799.1
NBCI Gene record:
Stx5a (56389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167799.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322475 CTTGGAGGTGGTCCCATAATT pLKO_005 847 CDS 100% 15.000 21.000 N Stx5a n/a
2 TRCN0000115082 GCAGAACATTGAGTCTACAAT pLKO.1 990 CDS 100% 5.625 7.875 N Stx5a n/a
3 TRCN0000322473 GCAGAACATTGAGTCTACAAT pLKO_005 990 CDS 100% 5.625 7.875 N Stx5a n/a
4 TRCN0000115081 GCAAGAATCCTCAAGAAGTAT pLKO.1 1604 3UTR 100% 5.625 4.500 N Stx5a n/a
5 TRCN0000115083 GCAGACCCATTCTAACACCAT pLKO.1 675 CDS 100% 2.640 2.112 N Stx5a n/a
6 TRCN0000350686 GCAGACCCATTCTAACACCAT pLKO_005 675 CDS 100% 2.640 2.112 N Stx5a n/a
7 TRCN0000218714 CAAGTCCCTCTTTGATGATAA pLKO_005 534 CDS 100% 13.200 9.240 N STX5 n/a
8 TRCN0000382023 GTTGTCTCCACCTTGAGATTT pLKO_005 1510 3UTR 100% 13.200 9.240 N Stx5a n/a
9 TRCN0000322414 GAAATTGAGGAGCTAACATAC pLKO_005 562 CDS 100% 10.800 7.560 N Stx5a n/a
10 TRCN0000322474 GAGGACAGGTGGCTACTATTG pLKO_005 1292 3UTR 100% 10.800 7.560 N Stx5a n/a
11 TRCN0000115085 GAGCTAACATACATCATCAAA pLKO.1 571 CDS 100% 5.625 3.938 N Stx5a n/a
12 TRCN0000115084 GCCGTCAGAATGGAATCCAAA pLKO.1 389 CDS 100% 4.950 3.465 N Stx5a n/a
13 TRCN0000059825 CCATTCAGAGATCCTCAAGTA pLKO.1 1125 CDS 100% 4.950 2.970 N STX5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167799.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11166 pDONR223 100% 76.1% 80.5% None (many diffs) n/a
2 ccsbBroad304_11166 pLX_304 0% 76.1% 80.5% V5 (many diffs) n/a
3 TRCN0000470119 TTAACGCCGAACCTCCTCTATGAC pLX_317 51.4% 76.1% 80.5% V5 (many diffs) n/a
4 ccsbBroadEn_11167 pDONR223 100% 61.5% 66.1% None (many diffs) n/a
5 ccsbBroad304_11167 pLX_304 0% 61.5% 66.1% V5 (many diffs) n/a
6 TRCN0000491829 AGATTACTTACAATGTCCTTTATT pLX_317 47.8% 61.5% 66.1% V5 (many diffs) n/a
Download CSV