Transcript: Human NM_001167903.2

Homo sapiens major facilitator superfamily domain containing 1 (MFSD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
MFSD1 (64747)
Length:
2117
CDS:
100..1380

Additional Resources:

NCBI RefSeq record:
NM_001167903.2
NBCI Gene record:
MFSD1 (64747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001167903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344891 GGGCATAATGCTAGGGAATAT pLKO_005 1837 3UTR 100% 13.200 18.480 N MFSD1 n/a
2 TRCN0000344948 TATCTGTGGTCTTACTCTATT pLKO_005 1280 CDS 100% 13.200 18.480 N MFSD1 n/a
3 TRCN0000059689 CCTCGGGATCACACTTATGAT pLKO.1 612 CDS 100% 5.625 7.875 N MFSD1 n/a
4 TRCN0000059692 GTCTTACTCTATTTGGTGAAT pLKO.1 1288 CDS 100% 4.950 6.930 N MFSD1 n/a
5 TRCN0000344892 ATCTTGGGTTGGCCATCATTT pLKO_005 1175 CDS 100% 13.200 9.240 N MFSD1 n/a
6 TRCN0000059690 CCTTAGCAGTTGCCCAGAATA pLKO.1 437 CDS 100% 13.200 9.240 N MFSD1 n/a
7 TRCN0000344890 GCCCTTCAGACTCAAGTTAAA pLKO_005 288 CDS 100% 13.200 9.240 N MFSD1 n/a
8 TRCN0000059691 GTGGCATTTGTAGTTCCTGAA pLKO.1 1111 CDS 100% 4.050 2.835 N MFSD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14246 pDONR223 100% 91.3% 87.9% None (many diffs) n/a
2 ccsbBroad304_14246 pLX_304 0% 91.3% 87.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472389 CAAACTAGACCTTGCACTCTCTGA pLX_317 30.9% 91.3% 87.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV