Transcript: Human NM_001167915.2

Homo sapiens ventricular zone expressed PH domain containing 1 (VEPH1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
VEPH1 (79674)
Length:
1745
CDS:
555..1196

Additional Resources:

NCBI RefSeq record:
NM_001167915.2
NBCI Gene record:
VEPH1 (79674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001167915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431457 TGACCAGGCAGTAGTTGAAAT pLKO_005 713 CDS 100% 13.200 18.480 N VEPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15987 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15987 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471028 CCGGGAAATGGTCAAATTATAAAT pLX_317 67.5% 100% 100% V5 n/a
4 ccsbBroadEn_04106 pDONR223 100% 23.6% 21.2% None (many diffs) n/a
5 ccsbBroad304_04106 pLX_304 0% 23.6% 21.2% V5 (many diffs) n/a
6 TRCN0000472697 CAATACCTGCAAAGTACAACAGAT pLX_317 16.6% 23.6% 21.2% V5 (many diffs) n/a
Download CSV