Construct: ORF TRCN0000472697
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011439.1_s317c1
- Derived from:
- ccsbBroadEn_04106
- DNA Barcode:
- CAATACCTGCAAAGTACAACAGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VEPH1 (79674)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472697
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79674 | VEPH1 | ventricular zone expressed ... | NM_001167912.2 | 100% | 100% | |
| 2 | human | 79674 | VEPH1 | ventricular zone expressed ... | NM_024621.2 | 100% | 100% | |
| 3 | human | 79674 | VEPH1 | ventricular zone expressed ... | XM_024453746.1 | 100% | 100% | |
| 4 | human | 79674 | VEPH1 | ventricular zone expressed ... | XM_024453747.1 | 100% | 100% | |
| 5 | human | 79674 | VEPH1 | ventricular zone expressed ... | XM_024453748.1 | 100% | 100% | |
| 6 | human | 79674 | VEPH1 | ventricular zone expressed ... | XM_011513134.2 | 94.7% | 92.5% | (many diffs) |
| 7 | human | 79674 | VEPH1 | ventricular zone expressed ... | NM_001167911.2 | 94.5% | 94.5% | 1873_1874ins135 |
| 8 | human | 79674 | VEPH1 | ventricular zone expressed ... | XM_011513135.2 | 94.5% | 94.4% | 0_1ins131;3_3delGinsCTTCA |
| 9 | human | 79674 | VEPH1 | ventricular zone expressed ... | NM_001167915.2 | 23.6% | 21.2% | (many diffs) |
| 10 | human | 79674 | VEPH1 | ventricular zone expressed ... | NM_001167916.2 | 23.6% | 21.2% | (many diffs) |
| 11 | human | 79674 | VEPH1 | ventricular zone expressed ... | NM_001167917.1 | 21.2% | 21.1% | 530T>G;531_532ins1968 |
| 12 | human | 79674 | VEPH1 | ventricular zone expressed ... | XM_024453749.1 | 21.2% | 21.1% | 530T>G;531_532ins1968 |
| 13 | human | 79674 | VEPH1 | ventricular zone expressed ... | XM_024453750.1 | 21.2% | 21.1% | 530T>G;531_532ins1968 |
| 14 | mouse | 72789 | Veph1 | ventricular zone expressed ... | NM_145820.3 | 85.3% | 85.4% | (many diffs) |
| 15 | mouse | 72789 | Veph1 | ventricular zone expressed ... | XM_006502142.3 | 81.9% | 82.1% | (many diffs) |
| 16 | mouse | 72789 | Veph1 | ventricular zone expressed ... | XM_006502143.3 | 75.4% | 76.2% | (many diffs) |
| 17 | mouse | 72789 | Veph1 | ventricular zone expressed ... | XM_011240244.2 | 19.7% | 19.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2568
- ORF length:
- 2499
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcatcaactg ttcagactgg ttttgggaca aaaagatctt tcacgagctg 121 gggacctctt ctccttagat gactctgaga ttgaagacag ccttacagaa gctttggagc 181 aaattaagat aattagctca tcttcagatt accaaaccaa taacaatgac caggcagtag 241 ttgaaatctg tatcacaaga atcacaacag ccatcagaga gaccgagtcc attgaaaagc 301 atgcaaaggc ccttgtgggg ctctgggact cctgcttgga acataacctg agaccctttg 361 ggaaagacga agacactcct catgcaaaaa tcgcatctga tatcatgagt tgcattttac 421 agaattacaa ccgaccccca gtgatggcat tagccatccc cattgcagtg aaattcctcc 481 acagaggcaa caaggaactg tgcaggaata tgtctaacta cctgtctctg gctgcaatta 541 ccaaggcaga tctcctggct gatcacacgg aagttatagt aaagagcata ctccaaggta 601 acaccatgtt gttgagagtg ttacctgctg tgtatgaaaa gcagcctcag ccaattaata 661 gacacctgac agaactcctg gccttgatgt ctcagctgga acagccagaa cagtaccatc 721 tactacggct tttgcatgta gcagcaaaga aaaaacaact cgaggtagtt cagaagtgta 781 ttcctttcct aattgggcat ttgaaggatt caacccataa tgacatcatc ctaaacatcc 841 tcatagagat agcagtctat gagccagtgg ctttgaacag ttttcttcca atgctgaaag 901 agattggtga gagattcccc tacctcactg gacagatggc aaggatttat ggagctgttg 961 ggcatgtgga tgaagagaga gccaggagct gcctgacata cctggtgagc caactggcca 1021 acatggagca ttcgtttcac catattctcc tgctggagat taaaagcatc accgacacct 1081 tctcctcaat cttgggccct cagagcagag acatcttccg catgagcaac agcttcaccg 1141 ccattgctaa actccttacc cgacaactgg aaaataccaa ggctggaagt ggcaggagaa 1201 aaatcagcac tgaaattgaa ttccctgaga aactggaaga aaccaagctc atagtaactg 1261 aaaatgaaga ccatgaaaaa ctccaagtta aaatccaggc ttttgaagac aagataaatg 1321 cagggagcaa tacccctggc tctatcagaa gatatagtct gggccaagtt tctaaagaag 1381 aaagaaaaaa cattagattt aacaggtcaa aaagtttggc tttccacact atgctcacaa 1441 agggtgtggg ttcagatgac ggcgaagatg aaaacagggg agacatacca gccagcatct 1501 ctctttcaga aatagaccca cttggccaag gaaatgacaa gctgccgttt aagacagaca 1561 ctgagagatc acagctgggg gagtcttcag tttcataccc aaatattata catatagact 1621 cagagaattt gtcagaaact gttaaagaaa actcccagga agaaactcca gagacaactg 1681 caagtcctat agaataccaa gataagctct acttgcactt aaaaaaaaac ctcagcaaag 1741 tgaaagcata tgccatggaa attggaaaga agattccagt ccctgatcag tgtaccattg 1801 aagacactgt gagaagttgt gtagcaaagt tgttcttcac ctgctccctg aagggtcatt 1861 actgcctata cagtaagtcc agttttattc tcatcagcca agaacctcag ccatggatcc 1921 agatcatgtt tctatttcag cagagcctgt ttcctgaacc cctgtccatt cagagtcatt 1981 ctgtgcaatt cctcagagct ctgtgggaga agacccaggc agggggtgct cacagctttg 2041 aaactgccat gatggagtcc acgtttccac agcagaagga tctggaccag gtacagctcc 2101 atctggaaga agtgaggttc tttgacgtgt ttggcttcag tgaaacagca ggagcatGGC 2161 AATGCTTCAT GTGCAACAAT CCTGAGAAAG CAACTGTTGT AAATCAAGAT GGCCAGCCTC 2221 TCATAGAAGG AAAACTTAAA GAGAAGCAAG TCAGATGGAA GTTCATCAAA AGGTGGAAAA 2281 CACGCTATTT TACACTGGCT GGAAATCAAC TTCTGTTTCA AAAAGGAAAG TCTAAAGATG 2341 ACCCTGACGA CTGCCCAATA GAACTCAGCA AAGTACAGAG TGTGAAGGCT GTGGCCAAGA 2401 AACGCAGGGA CCGCTCTCTC CCCCGGGCTT TCGAAATCTT CACAGACAAT AAAACCTATG 2461 TCTTTAAGGC CAAGGATGAG AAGAATGCAG AAGAATGGCT CCAGTGCATC AACGTGGCAG 2521 TTGCCCAAGC CAAAGAAAGG GAAAGTAGAG AAGTAACCAC ATATCTGTTG CCAACTTTCT 2581 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 2641 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 2701 GTGGAAAGGA CGACAATACC TGCAAAGTAC AACAGATACG CGTTAAGTCg acaatcaacc 2761 tctggattac aaaatttgtg aaagatt