Transcript: Mouse NM_001167920.1

Mus musculus solute carrier family 8 (sodium/calcium exchanger), member 3 (Slc8a3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc8a3 (110893)
Length:
4943
CDS:
602..3367

Additional Resources:

NCBI RefSeq record:
NM_001167920.1
NBCI Gene record:
Slc8a3 (110893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068486 GCACAACTACAATTCGGGTAT pLKO.1 966 CDS 100% 4.050 5.670 N Slc8a3 n/a
2 TRCN0000068485 CCAGCAATACTCAATAGTCTT pLKO.1 2099 CDS 100% 4.950 3.960 N Slc8a3 n/a
3 TRCN0000068484 CCCAAACTAGAGGTCATCATT pLKO.1 2573 CDS 100% 5.625 3.938 N Slc8a3 n/a
4 TRCN0000068487 GCCCTGATATACATGTTTCTT pLKO.1 848 CDS 100% 5.625 3.938 N Slc8a3 n/a
5 TRCN0000068483 CCGGATTCTAAAGGATCTGAA pLKO.1 1552 CDS 100% 4.950 3.465 N Slc8a3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4660 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06963 pDONR223 100% 28% 30.1% None (many diffs) n/a
2 ccsbBroad304_06963 pLX_304 0% 28% 30.1% V5 (many diffs) n/a
3 TRCN0000475701 TTGTACCCCTCCATCTAGGCTCTG pLX_317 40.9% 28% 30.1% V5 (many diffs) n/a
Download CSV