Transcript: Human NM_001168254.1

Homo sapiens OCIA domain containing 1 (OCIAD1), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
OCIAD1 (54940)
Length:
2024
CDS:
217..969

Additional Resources:

NCBI RefSeq record:
NM_001168254.1
NBCI Gene record:
OCIAD1 (54940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001168254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274956 ACTGGTATTACTGATCATATT pLKO_005 751 CDS 100% 13.200 18.480 N OCIAD1 n/a
2 TRCN0000167524 GCAGTCTTCATAAACACATTT pLKO.1 1055 3UTR 100% 13.200 18.480 N OCIAD1 n/a
3 TRCN0000275024 GCAGTCTTCATAAACACATTT pLKO_005 1055 3UTR 100% 13.200 18.480 N OCIAD1 n/a
4 TRCN0000167946 CGAGATTACAATGCTCTAGAA pLKO.1 1259 3UTR 100% 4.950 6.930 N OCIAD1 n/a
5 TRCN0000285274 CGAGATTACAATGCTCTAGAA pLKO_005 1259 3UTR 100% 4.950 6.930 N OCIAD1 n/a
6 TRCN0000274955 CTTTCAAGTCATCCCAAATAT pLKO_005 430 CDS 100% 15.000 10.500 N OCIAD1 n/a
7 TRCN0000275025 TCACCACCTGGGCACTATTAT pLKO_005 598 CDS 100% 15.000 10.500 N OCIAD1 n/a
8 TRCN0000167361 GAATAAGAACAGAGAGTCATA pLKO.1 840 CDS 100% 4.950 3.465 N OCIAD1 n/a
9 TRCN0000168753 GCAGACAACATAGAAATGCTT pLKO.1 679 CDS 100% 3.000 2.100 N OCIAD1 n/a
10 TRCN0000167736 GCAACAAGTATGTTGATTACT pLKO.1 385 CDS 100% 0.563 0.394 N OCIAD1 n/a
11 TRCN0000168467 GCTGCAACAAGTATGTTGATT pLKO.1 382 CDS 100% 0.563 0.394 N OCIAD1 n/a
12 TRCN0000168595 GCTTGTATCATGGGATACTTT pLKO.1 475 CDS 100% 0.563 0.394 N OCIAD1 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1632 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03490 pDONR223 100% 98% 98% None 1_15del n/a
2 ccsbBroad304_03490 pLX_304 0% 98% 98% V5 1_15del n/a
3 TRCN0000474961 GGGTACGGAACGTCACGCGGCCGC pLX_317 74.3% 98% 98% V5 1_15del n/a
Download CSV