Transcript: Human NM_001168301.1

Homo sapiens kelch like family member 13 (KLHL13), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
KLHL13 (90293)
Length:
3121
CDS:
89..2008

Additional Resources:

NCBI RefSeq record:
NM_001168301.1
NBCI Gene record:
KLHL13 (90293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001168301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137334 GTGCTTGCACACTCACAGTTT pLKO.1 1929 CDS 100% 4.950 6.930 N KLHL13 n/a
2 TRCN0000135888 GAATGGACCTATGTTGCCAAA pLKO.1 1439 CDS 100% 4.050 2.835 N KLHL13 n/a
3 TRCN0000134615 GTGCAGAAATATGATCCAGAT pLKO.1 1856 CDS 100% 4.050 2.835 N KLHL13 n/a
4 TRCN0000135382 GCTAGTGATTACTTCAAGGCT pLKO.1 383 CDS 100% 0.750 0.525 N KLHL13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08613 pDONR223 100% 83% 88.4% None (many diffs) n/a
2 ccsbBroad304_08613 pLX_304 0% 83% 88.4% V5 (many diffs) n/a
3 TRCN0000480620 CGGATATTAATTAGCAACCTAAAC pLX_317 19.4% 83% 88.4% V5 (many diffs) n/a
Download CSV