Construct: ORF TRCN0000480620
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000276.1_s317c1
- Derived from:
- ccsbBroadEn_08613
- DNA Barcode:
- CGGATATTAATTAGCAACCTAAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KLHL9 (55958)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480620
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55958 | KLHL9 | kelch like family member 9 | NM_018847.4 | 99.9% | 100% | 459C>T |
| 2 | human | 90293 | KLHL13 | kelch like family member 13 | NM_001168303.1 | 86.5% | 92.2% | (many diffs) |
| 3 | human | 90293 | KLHL13 | kelch like family member 13 | NM_001168301.1 | 83% | 88.4% | (many diffs) |
| 4 | human | 90293 | KLHL13 | kelch like family member 13 | NM_001168302.1 | 83% | 88.4% | (many diffs) |
| 5 | human | 90293 | KLHL13 | kelch like family member 13 | XM_017029950.1 | 83% | 88.4% | (many diffs) |
| 6 | human | 90293 | KLHL13 | kelch like family member 13 | NM_001168300.1 | 81.7% | 87.1% | (many diffs) |
| 7 | human | 90293 | KLHL13 | kelch like family member 13 | NM_033495.3 | 81% | 86.3% | (many diffs) |
| 8 | human | 90293 | KLHL13 | kelch like family member 13 | XM_011531411.1 | 81% | 86.3% | (many diffs) |
| 9 | human | 90293 | KLHL13 | kelch like family member 13 | NM_001168299.1 | 80.6% | 85.9% | (many diffs) |
| 10 | human | 90293 | KLHL13 | kelch like family member 13 | XM_011531409.3 | 80.2% | 85.5% | (many diffs) |
| 11 | human | 90293 | KLHL13 | kelch like family member 13 | XM_011531410.3 | 80.2% | 85.5% | (many diffs) |
| 12 | mouse | 242521 | Klhl9 | kelch-like 9 | NM_172871.2 | 91.5% | 98.7% | (many diffs) |
| 13 | mouse | 67455 | Klhl13 | kelch-like 13 | NM_026167.4 | 79.7% | 85.6% | (many diffs) |
| 14 | mouse | 67455 | Klhl13 | kelch-like 13 | XM_011247492.2 | 79.7% | 85.6% | (many diffs) |
| 15 | mouse | 67455 | Klhl13 | kelch-like 13 | XM_011247493.2 | 79.7% | 85.6% | (many diffs) |
| 16 | mouse | 67455 | Klhl13 | kelch-like 13 | XM_011247494.2 | 79.7% | 85.6% | (many diffs) |
| 17 | mouse | 67455 | Klhl13 | kelch-like 13 | XM_017318610.1 | 79.7% | 85.6% | (many diffs) |
| 18 | mouse | 67455 | Klhl13 | kelch-like 13 | NM_001310466.1 | 79.5% | 85.4% | (many diffs) |
| 19 | mouse | 67455 | Klhl13 | kelch-like 13 | NM_001290476.2 | 78.5% | 84.3% | (many diffs) |
| 20 | mouse | 67455 | Klhl13 | kelch-like 13 | XM_011247489.2 | 77.8% | 83.6% | (many diffs) |
| 21 | mouse | 67455 | Klhl13 | kelch-like 13 | XM_011247488.2 | 77.5% | 83.2% | (many diffs) |
| 22 | mouse | 67455 | Klhl13 | kelch-like 13 | XM_011247484.2 | 77.1% | 82.8% | (many diffs) |
| 23 | mouse | 67455 | Klhl13 | kelch-like 13 | XM_011247485.2 | 77.1% | 82.8% | (many diffs) |
| 24 | mouse | 67455 | Klhl13 | kelch-like 13 | XM_011247486.2 | 77.1% | 82.8% | (many diffs) |
| 25 | mouse | 67455 | Klhl13 | kelch-like 13 | XM_011247487.2 | 77.1% | 82.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1920
- ORF length:
- 1851
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaaagtgtcc cttggtaacg gcgaaatggg cgtctctgcc catttgcagc 121 cttgtaaggc aggaaccaca cgctttttta ccagcaatac tcacagttcg gtggtattgc 181 aaggctttga tcagcttaga atagaaggat tgctttgtga tgtgaccctg gtaccaggtg 241 atggagatga aatcttccct gttcacagag ctatgatggc gtctgctagt gattatttca 301 aagccatgtt cacaggtgga atgaaagaac aagatttgat gtgcattaag cttcatgggg 361 tgaacaaggt tggtctgaag aaaatcattg attttattta tactgcaaaa ctttctctta 421 atatggacaa tcttcaggac acacttgaag ctgctagctt tttacaaata ttacccgttt 481 tggatttctg taaagtattt cttatatcag gagtctcttt ggataattgt gttgaggttg 541 gacgaattgc taacacctac aatcttatag aagtggataa atatgttaat aatttcatcc 601 tgaagaactt tcctgcttta ttgagtactg gggagtttct aaaactccct tttgaacgac 661 ttgcatttgt gctttccagt aatagtctta agcactgtac cgaacttgaa ctctttaagg 721 cagcctgtcg ctggctaagg ttggaagacc ctcggatgga ttatgctgca aagttaatga 781 agaatattcg atttccactg atgacaccac aggatctcat caattacgtg cagacagtag 841 atttcatgag aacagacaat acctgcgtga atttgctttt ggaagctagc aattaccaaa 901 tgatgccata tatgcagcca gtgatgcagt cagatagaac tgccattcga tctgactcca 961 ctcacttggt tacattagga ggagttttga ggcagcagct ggttgtcagt aaagaattac 1021 ggatgtatga tgaaagggca caagaatgga gatctttagc cccaatggat gctccccgtt 1081 accagcatgg tattgctgtc attggaaact ttctttatgt agttggtggt cagagtaatt 1141 atgatacaaa aggaaaaact gctgttgata cagttttcag atttgatcct cggtataata 1201 aatggatgca ggttgcatca ttaaatgaaa agcgcacatt ctttcacttg agtgccctca 1261 aaggacattt gtatgcagtt ggtgggcgca gtgcagctgg tgaactggcc acagtagaat 1321 gttacaaccc aagaatgaat gagtggagct atgttgcaaa aatgagtgaa ccccactatg 1381 gtcatgctgg aacagtatat ggaggcttaa tgtatatttc aggaggaatt acccatgaca 1441 ctttccaaaa tgagctcatg tgttttgacc cagatacaga taaatggatg caaaaggctc 1501 caatgactac agtcagaggt ctgcattgca tgtgtacagt tggagataag ctctatgtca 1561 ttggtgGCAA TCACTTCAGA GGAACAAGTG ATTATGATGA TGTTCTAAGC TGTGAATACT 1621 ATTCACCAAC CCTTGACCAG TGGACCCCAA TTGCCGCCAT GTTAAGAGGC CAAAGTGATG 1681 TTGGAGTTGC CGTCTTTGAA AATAAAATCT ATGTTGTTGG TGGATATTCT TGGAATAATC 1741 GTTGTATGGT AGAAATTGTC CAGAAATATG ACCCAGAAAA AGATGAGTGG CATAAAGTTT 1801 TTGATCTTCC AGAGTCACTT GGTGGCATTC GAGCCTGTAC ACTCACAGTT TTTCCACCTG 1861 AAGAAAACCC TGGGTCACCT TCTAGAGAAT CACCTCTTTC AGCACCTTCA GATCATTCTT 1921 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1981 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 2041 TTTATATATC TTGTGGAAAG GACGACGGAT ATTAATTAGC AACCTAAACA CGCGTTAAGT 2101 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt