Transcript: Mouse NM_001168358.1

Mus musculus tRNA-yW synthesizing protein 3 homolog (S. cerevisiae) (Tyw3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Mus musculus (mouse)
Gene:
Tyw3 (209584)
Length:
4270
CDS:
73..507

Additional Resources:

NCBI RefSeq record:
NM_001168358.1
NBCI Gene record:
Tyw3 (209584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250615 ACTCACATTCCAAGATCAAAG pLKO_005 546 3UTR 100% 10.800 15.120 N Tyw3 n/a
2 TRCN0000250618 ATCTCATCAAATCGAGTAAAT pLKO_005 1737 3UTR 100% 13.200 10.560 N Tyw3 n/a
3 TRCN0000250619 ACATGCTCTCAAACGAGAAAC pLKO_005 517 3UTR 100% 10.800 7.560 N Tyw3 n/a
4 TRCN0000250617 GCACTCAGTGGCAATTGATTC pLKO_005 426 CDS 100% 10.800 7.560 N Tyw3 n/a
5 TRCN0000177015 GAAACCATTTCAAACTCACAT pLKO.1 533 3UTR 100% 4.950 3.465 N Tyw3 n/a
6 TRCN0000197896 GCAAGAGTTAATTTCTCTGTT pLKO.1 803 3UTR 100% 4.950 3.465 N Tyw3 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3671 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.