Transcript: Mouse NM_001168590.1

Mus musculus RIKEN cDNA 2010106E10 gene (2010106E10Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
2010106E10Rik (67715)
Length:
1287
CDS:
74..913

Additional Resources:

NCBI RefSeq record:
NM_001168590.1
NBCI Gene record:
2010106E10Rik (67715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168590.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174423 CCTTACAACTATCCATATCTT pLKO.1 683 CDS 100% 5.625 7.875 N 2010106E10Rik n/a
2 TRCN0000444340 GGTTTCTGCCCAGAGTCTATT pLKO_005 197 CDS 100% 13.200 10.560 N 2010106E10Rik n/a
3 TRCN0000175399 CGGTTTATGAAGAGTCAGAAA pLKO.1 849 CDS 100% 4.950 3.960 N 2010106E10Rik n/a
4 TRCN0000426141 CCAGAACAAATTCCAACTTTA pLKO_005 636 CDS 100% 13.200 9.240 N 2010106E10Rik n/a
5 TRCN0000193320 CCAGATGCAGATATTTGTTAT pLKO.1 1137 3UTR 100% 13.200 9.240 N 2010106E10Rik n/a
6 TRCN0000174627 GTACATCTGTGAAAGACTTTA pLKO.1 153 CDS 100% 13.200 9.240 N 2010106E10Rik n/a
7 TRCN0000193641 CCATGCTCTACATACTTTGTT pLKO.1 998 3UTR 100% 5.625 3.938 N 2010106E10Rik n/a
8 TRCN0000176200 GCAAACATGATACCCAACTAT pLKO.1 890 CDS 100% 5.625 3.938 N 2010106E10Rik n/a
9 TRCN0000175951 GAGAAGAGTATGTCAGAACTT pLKO.1 449 CDS 100% 4.950 3.465 N 2010106E10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168590.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.