Transcript: Mouse NM_001170486.1

Mus musculus actin related protein 2/3 complex, subunit 4 (Arpc4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Mus musculus (mouse)
Gene:
Arpc4 (68089)
Length:
2152
CDS:
245..481

Additional Resources:

NCBI RefSeq record:
NM_001170486.1
NBCI Gene record:
Arpc4 (68089)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091282 GCAGGCCGATGAAATTGAGAA pLKO.1 205 5UTR 100% 4.950 6.930 N Arpc4 n/a
2 TRCN0000036510 GCGAGCAGAGAACTTCTTTAT pLKO.1 262 CDS 100% 13.200 9.240 N ARPC4 n/a
3 TRCN0000380236 TGCGAGCAGAGAACTTCTTTA pLKO_005 261 CDS 100% 13.200 9.240 N Arpc4 n/a
4 TRCN0000382409 TGTGAAGCAGGCCGATGAAAT pLKO_005 199 5UTR 100% 13.200 9.240 N Arpc4 n/a
5 TRCN0000382349 ACACGGAGCAGATGTACAAAC pLKO_005 339 CDS 100% 10.800 7.560 N Arpc4 n/a
6 TRCN0000379607 AGATGAAGCTGTCGGTCAATG pLKO_005 417 CDS 100% 10.800 7.560 N Arpc4 n/a
7 TRCN0000375024 GGAAACCTGTGGAGGGATATG pLKO_005 291 CDS 100% 10.800 7.560 N Arpc4 n/a
8 TRCN0000091279 CCATAAATTCATGCGCTTCAT pLKO.1 235 5UTR 100% 4.950 3.465 N Arpc4 n/a
9 TRCN0000326259 CCATAAATTCATGCGCTTCAT pLKO_005 235 5UTR 100% 4.950 3.465 N Arpc4 n/a
10 TRCN0000091281 AGTAGCAAAGAACTGCTATTA pLKO.1 98 5UTR 100% 1.320 0.924 N Arpc4 n/a
11 TRCN0000326260 AGTAGCAAAGAACTGCTATTA pLKO_005 98 5UTR 100% 1.320 0.924 N Arpc4 n/a
12 TRCN0000091280 GCTGAGGAGTTCCTCAAGAAT pLKO.1 455 CDS 100% 0.563 0.394 N Arpc4 n/a
13 TRCN0000091278 GCTGTCTTACAAGCCTCCTTA pLKO.1 986 3UTR 100% 4.950 2.475 Y Arpc4 n/a
14 TRCN0000326316 GCTGTCTTACAAGCCTCCTTA pLKO_005 986 3UTR 100% 4.950 2.475 Y Arpc4 n/a
15 TRCN0000380556 ATCCACTTCATGGAGGAGATT pLKO_005 380 CDS 100% 4.950 3.465 N ARPC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02310 pDONR223 100% 43.2% 46.4% None (many diffs) n/a
2 ccsbBroad304_02310 pLX_304 0% 43.2% 46.4% V5 (many diffs) n/a
3 TRCN0000473674 CAGACCGGTTTTTCCCAGCATCCC pLX_317 71.7% 43.2% 46.4% V5 (many diffs) n/a
Download CSV