Transcript: Human NM_001170628.1

Homo sapiens AF4/FMR2 family member 2 (AFF2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
AFF2 (2334)
Length:
12280
CDS:
91..2949

Additional Resources:

NCBI RefSeq record:
NM_001170628.1
NBCI Gene record:
AFF2 (2334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230276 CGGTTCACAATGCTGATTATT pLKO_005 2216 CDS 100% 15.000 21.000 N AFF2 n/a
2 TRCN0000230277 TAATTACCTGCTGGTATATAA pLKO_005 4473 3UTR 100% 15.000 21.000 N AFF2 n/a
3 TRCN0000230275 ACCACTGACAGCGAATCTAAT pLKO_005 523 CDS 100% 13.200 18.480 N AFF2 n/a
4 TRCN0000119088 CCGATGTTTATCACTCCTCTA pLKO.1 2493 CDS 100% 4.050 5.670 N AFF2 n/a
5 TRCN0000218713 GTACTATGCTACCGATGTTTA pLKO_005 2482 CDS 100% 13.200 10.560 N AFF2 n/a
6 TRCN0000257129 TGATGCACTGTTCGAGAAATT pLKO_005 2271 CDS 100% 13.200 10.560 N AFF2 n/a
7 TRCN0000119087 GCCTTTAATATGCTGGGTTAT pLKO.1 4503 3UTR 100% 10.800 7.560 N AFF2 n/a
8 TRCN0000119091 CGATGTTTATCACTCCTCTAT pLKO.1 2494 CDS 100% 4.950 3.465 N AFF2 n/a
9 TRCN0000119090 GCCGACAAACTGACAAGAGAA pLKO.1 2800 CDS 100% 4.950 3.465 N AFF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06219 pDONR223 100% 71.8% 71.1% None (many diffs) n/a
2 ccsbBroad304_06219 pLX_304 0% 71.8% 71.1% V5 (many diffs) n/a
3 TRCN0000480612 CGTGCTGAAAAAACACGTATAAAG pLX_317 9.1% 71.8% 71.1% V5 (many diffs) n/a
Download CSV