Transcript: Mouse NM_001171187.1

Mus musculus myelin and lymphocyte protein, T cell differentiation protein (Mal), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mal (17153)
Length:
2624
CDS:
563..856

Additional Resources:

NCBI RefSeq record:
NM_001171187.1
NBCI Gene record:
Mal (17153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001171187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100669 CAATGTTTGATGGCTTTACTT pLKO.1 729 CDS 100% 5.625 3.938 N Mal n/a
2 TRCN0000100667 GCCACCATCTCAATGTTTGAT pLKO.1 719 CDS 100% 5.625 3.938 N Mal n/a
3 TRCN0000100665 GCTCCTTTGAAATGCTTCATT pLKO.1 1348 3UTR 100% 5.625 3.938 N Mal n/a
4 TRCN0000100666 CCTTAATCAGATGGAAGTCTT pLKO.1 831 CDS 100% 4.950 3.465 N Mal n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00971 pDONR223 100% 54.4% 55.5% None (many diffs) n/a
2 ccsbBroad304_00971 pLX_304 0% 54.4% 55.5% V5 (many diffs) n/a
3 TRCN0000473853 AGATTTAGCGGCTTCATCCCCAAA pLX_317 100% 54.4% 55.5% V5 (many diffs) n/a
Download CSV