Transcript: Mouse NM_001171582.1

Mus musculus methionine-tRNA synthetase (Mars), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-09
Taxon:
Mus musculus (mouse)
Gene:
Mars (216443)
Length:
2972
CDS:
158..2890

Additional Resources:

NCBI RefSeq record:
NM_001171582.1
NBCI Gene record:
Mars (216443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001171582.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076009 GCTAGTGCAATCTGCCGATAT pLKO.1 341 CDS 100% 10.800 15.120 N Mars n/a
2 TRCN0000076008 CGGCATATCGTTCGATACTTT pLKO.1 1204 CDS 100% 5.625 7.875 N Mars n/a
3 TRCN0000076010 CGTCTGGTTTGATGCTACTAT pLKO.1 1711 CDS 100% 5.625 7.875 N Mars n/a
4 TRCN0000076012 GTGGCTAAACTCTTGGATCTA pLKO.1 2804 CDS 100% 4.950 6.930 N Mars n/a
5 TRCN0000293875 CTAGTGCAATCTGCCGATATT pLKO_005 342 CDS 100% 0.000 0.000 N MARS1 n/a
6 TRCN0000076011 GCACATCATTGCTACAGAGTA pLKO.1 1900 CDS 100% 4.950 3.465 N Mars n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171582.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06561 pDONR223 100% 86.2% 88.5% None (many diffs) n/a
2 ccsbBroad304_06561 pLX_304 0% 86.2% 88.5% V5 (many diffs) n/a
3 TRCN0000480984 CCACTAGCCGGCTGCACGCGCTAG pLX_317 13.9% 86.2% 88.5% V5 (many diffs) n/a
Download CSV