Transcript: Human NM_001171747.1

Homo sapiens chromosome 3 open reading frame 52 (C3orf52), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
C3orf52 (79669)
Length:
2054
CDS:
74..826

Additional Resources:

NCBI RefSeq record:
NM_001171747.1
NBCI Gene record:
C3orf52 (79669)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171747.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369896 CCCTGGAGCTCCTGTAATAAG pLKO_005 227 CDS 100% 13.200 18.480 N C3orf52 n/a
2 TRCN0000364850 AGTGATCATCATAGGCTTATG pLKO_005 310 CDS 100% 10.800 7.560 N C3orf52 n/a
3 TRCN0000377342 GACAAGGTCTTCCCTTCTTTG pLKO_005 167 CDS 100% 10.800 7.560 N C3orf52 n/a
4 TRCN0000144394 CCACCAAGGTTACTTTGAAAT pLKO.1 1161 3UTR 100% 13.200 7.920 N C3orf52 n/a
5 TRCN0000121764 CCAATTATTCACTGAAGTCAT pLKO.1 993 3UTR 100% 4.950 2.970 N C3orf52 n/a
6 TRCN0000143816 GCTTATGTCTTGCTGCAGTAA pLKO.1 324 CDS 100% 4.950 2.970 N C3orf52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171747.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12588 pDONR223 100% 41.3% 27.3% None (many diffs) n/a
2 ccsbBroad304_12588 pLX_304 0% 41.3% 27.3% V5 (many diffs) n/a
3 TRCN0000467331 ATTAGTGATGACCTCCACCAATAT pLX_317 95.5% 41.3% 27.3% V5 (many diffs) n/a
Download CSV