Transcript: Human NM_001171888.1

Homo sapiens FGFR1 oncogene partner 2 (FGFR1OP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-22
Taxon:
Homo sapiens (human)
Gene:
FGFR1OP2 (26127)
Length:
998
CDS:
354..872

Additional Resources:

NCBI RefSeq record:
NM_001171888.1
NBCI Gene record:
FGFR1OP2 (26127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127865 GAGCAAGTACCGAGAACAAAT pLKO.1 656 CDS 100% 13.200 7.920 N FGFR1OP2 n/a
2 TRCN0000350767 GAGCAAGTACCGAGAACAAAT pLKO_005 656 CDS 100% 13.200 7.920 N FGFR1OP2 n/a
3 TRCN0000127612 CGTACATCTCTGGAAGAACAT pLKO.1 612 CDS 100% 4.950 2.970 N FGFR1OP2 n/a
4 TRCN0000336829 CGTACATCTCTGGAAGAACAT pLKO_005 612 CDS 100% 4.950 2.970 N FGFR1OP2 n/a
5 TRCN0000336753 GCCACGGTCCACGTTAGTTAT pLKO_005 533 CDS 100% 13.200 6.600 Y FGFR1OP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02918 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02918 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480334 CCAATTAGCTTCCAACTTATCCCT pLX_317 73.6% 100% 100% V5 n/a
Download CSV