Transcript: Human NM_001172.4

Homo sapiens arginase 2 (ARG2), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ARG2 (384)
Length:
1911
CDS:
59..1123

Additional Resources:

NCBI RefSeq record:
NM_001172.4
NBCI Gene record:
ARG2 (384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369933 CAAGAGAAGGAGGGCATATTG pLKO_005 1035 CDS 100% 13.200 10.560 N ARG2 n/a
2 TRCN0000051020 CCCTTACCACTTCATCAGGAA pLKO.1 510 CDS 100% 2.640 2.112 N ARG2 n/a
3 TRCN0000333446 CCCTTACCACTTCATCAGGAA pLKO_005 510 CDS 100% 2.640 2.112 N ARG2 n/a
4 TRCN0000051019 CCTATCGAGAAGGCATGTATA pLKO.1 873 CDS 100% 13.200 9.240 N ARG2 n/a
5 TRCN0000333447 CCTATCGAGAAGGCATGTATA pLKO_005 873 CDS 100% 13.200 9.240 N ARG2 n/a
6 TRCN0000369866 GAACTATGATATCCAGTATTT pLKO_005 688 CDS 100% 13.200 9.240 N ARG2 n/a
7 TRCN0000051018 CGAACATTTGATCTGCTGATT pLKO.1 755 CDS 100% 4.950 3.465 N ARG2 n/a
8 TRCN0000363741 CGAACATTTGATCTGCTGATT pLKO_005 755 CDS 100% 4.950 3.465 N ARG2 n/a
9 TRCN0000051021 GCGAGTGCATTCCATCCTGAA pLKO.1 97 CDS 100% 4.050 2.835 N ARG2 n/a
10 TRCN0000051022 GTTCACCAGATGAATCAGAAA pLKO.1 1080 CDS 100% 4.950 2.970 N ARG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00099 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00099 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468965 ATTGGGCATGGAAGTTAGTTAGAA pLX_317 44.6% 100% 100% V5 n/a
Download CSV