Transcript: Human NM_001172085.1

Homo sapiens TATA-box binding protein (TBP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
TBP (6908)
Length:
1719
CDS:
138..1097

Additional Resources:

NCBI RefSeq record:
NM_001172085.1
NBCI Gene record:
TBP (6908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172085.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257112 GTGCCCGAAACGCCGAATATA pLKO_005 634 CDS 100% 15.000 21.000 N TBP n/a
2 TRCN0000218795 GGTTGTAAACTTGACCTAAAG pLKO_005 600 CDS 100% 10.800 15.120 N TBP n/a
3 TRCN0000071981 CTTTAGTCCAATGATGCCTTA pLKO.1 158 CDS 100% 4.050 5.670 N Tbp n/a
4 TRCN0000014796 CCACAGTGAATCTTGGTTGTA pLKO.1 586 CDS 100% 4.950 3.960 N TBP n/a
5 TRCN0000321497 CCAGAATTGTTCTCCTTATTT pLKO_005 970 CDS 100% 15.000 10.500 N Tbp n/a
6 TRCN0000230188 TGTTAAAGCCACCTCTATAAT pLKO_005 1416 3UTR 100% 15.000 10.500 N TBP n/a
7 TRCN0000230187 CACCAACAATTTAGTAGTTAT pLKO_005 906 CDS 100% 13.200 9.240 N TBP n/a
8 TRCN0000230186 CAAGCGGTTTGCTGCGGTAAT pLKO_005 659 CDS 100% 10.800 7.560 N TBP n/a
9 TRCN0000014795 CCCTATCTTTAGTCCAATGAT pLKO.1 152 CDS 100% 5.625 3.938 N TBP n/a
10 TRCN0000014797 CCCACCAACAATTTAGTAGTT pLKO.1 904 CDS 100% 4.950 3.465 N TBP n/a
11 TRCN0000014794 GCCAGAGTTATTTCCTGGTTT pLKO.1 929 CDS 100% 4.950 3.465 N TBP n/a
12 TRCN0000014793 CCTCTATAATTGATTGGACTT pLKO.1 1427 3UTR 100% 4.050 2.835 N TBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172085.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11173 pDONR223 100% 79% 79% None 0_1ins60;111_263del n/a
2 ccsbBroad304_11173 pLX_304 0% 79% 79% V5 0_1ins60;111_263del n/a
3 TRCN0000473630 GGATCTACCGCTCGGTTCCTAACC pLX_317 28.7% 79% 79% V5 0_1ins60;111_263del n/a
Download CSV