Transcript: Human NM_001172086.1

Homo sapiens peroxisomal biogenesis factor 2 (PEX2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
PEX2 (5828)
Length:
4385
CDS:
465..1382

Additional Resources:

NCBI RefSeq record:
NM_001172086.1
NBCI Gene record:
PEX2 (5828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237820 ATTAGGTGGGCTGATTAATTT pLKO_005 905 CDS 100% 15.000 21.000 N PEX2 n/a
2 TRCN0000003429 AGTCATCCTAAGTATACCATT pLKO.1 1440 3UTR 100% 4.950 6.930 N PEX2 n/a
3 TRCN0000003428 GAATACATGAATAGGGAACTT pLKO.1 1029 CDS 100% 4.950 6.930 N PEX2 n/a
4 TRCN0000003430 CTAAGAATAAGCCAGTTGGAT pLKO.1 507 CDS 100% 3.000 4.200 N PEX2 n/a
5 TRCN0000003431 GTTGGCTTTGAATACATGAAT pLKO.1 1020 CDS 100% 5.625 4.500 N PEX2 n/a
6 TRCN0000237822 CCATAGGATGTGAGCATATTT pLKO_005 1231 CDS 100% 15.000 10.500 N PEX2 n/a
7 TRCN0000237818 TAGTATGAACAGCACTATTTA pLKO_005 2267 3UTR 100% 15.000 10.500 N PEX2 n/a
8 TRCN0000237821 CTCTTACTGGTGCACCTAATA pLKO_005 1141 CDS 100% 13.200 9.240 N PEX2 n/a
9 TRCN0000237819 AGAGGTGAAAGCGTGCTTATG pLKO_005 626 CDS 100% 10.800 7.560 N PEX2 n/a
10 TRCN0000003432 ACCACTTATCAATGTCCAGAA pLKO.1 1088 CDS 100% 4.050 2.835 N PEX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01352 pDONR223 100% 100% 100% None n/a
2 TRCN0000474120 CAATGAGTATTAATGCGAAAAACC pLX_317 44.7% 100% 100% V5 n/a
Download CSV