Transcript: Human NM_001172415.2

Homo sapiens BAG cochaperone 1 (BAG1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
BAG1 (573)
Length:
3820
CDS:
380..1072

Additional Resources:

NCBI RefSeq record:
NM_001172415.2
NBCI Gene record:
BAG1 (573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417994 GAGCGGAATTTACCTGATTTC pLKO_005 1134 3UTR 100% 10.800 15.120 N BAG1 n/a
2 TRCN0000412303 CCGAGTGAGGTGTAGCAGAAA pLKO_005 1065 CDS 100% 4.950 6.930 N BAG1 n/a
3 TRCN0000007297 GAAACACCGTTGTCAGCACTT pLKO.1 635 CDS 100% 4.050 5.670 N BAG1 n/a
4 TRCN0000432993 ATGGTTGCCGGGTCATGTTAA pLKO_005 666 CDS 100% 13.200 9.240 N BAG1 n/a
5 TRCN0000420248 GCCACAATAGAGCAGTTTATG pLKO_005 872 CDS 100% 13.200 9.240 N BAG1 n/a
6 TRCN0000429987 TTGGGCCAGTTTCAGGTTTAT pLKO_005 1394 3UTR 100% 13.200 9.240 N BAG1 n/a
7 TRCN0000007296 GCAAACTTGATAGGAGAGTAA pLKO.1 849 CDS 100% 4.950 3.465 N BAG1 n/a
8 TRCN0000418604 TCCACAGGAAGAGGTTGAACT pLKO_005 703 CDS 100% 4.950 3.465 N BAG1 n/a
9 TRCN0000007298 TGTCACCCACAGCAATGAGAA pLKO.1 475 CDS 100% 4.950 3.465 N BAG1 n/a
10 TRCN0000011082 GCAGTCTACAAACTTTGCCCT pLKO.1 1042 CDS 100% 0.660 0.462 N BAG1 n/a
11 TRCN0000415671 AGTTGACCCTGAGTGAGGAAG pLKO_005 306 5UTR 100% 4.050 2.430 N BAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00147 pDONR223 100% 83.9% 83.9% None 0_1ins132 n/a
2 ccsbBroad304_00147 pLX_304 0% 83.9% 83.9% V5 0_1ins132 n/a
3 TRCN0000470464 AACGCGCCACTCAAAGATTACGCG pLX_317 45.2% 83.9% 83.9% V5 0_1ins132 n/a
Download CSV