Transcript: Human NM_001172416.1

Homo sapiens potassium inwardly rectifying channel subfamily J member 13 (KCNJ13), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
KCNJ13 (3769)
Length:
3373
CDS:
138..422

Additional Resources:

NCBI RefSeq record:
NM_001172416.1
NBCI Gene record:
KCNJ13 (3769)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435110 CAGAATAAGACTTATCCATTT pLKO_005 977 3UTR 100% 10.800 15.120 N KCNJ13 n/a
2 TRCN0000044549 GCGTTGGATGATGTTGGTCTT pLKO.1 296 CDS 100% 4.050 5.670 N KCNJ13 n/a
3 TRCN0000044550 CCTTCTCACTTTGAATTAGTT pLKO.1 685 3UTR 100% 5.625 3.938 N KCNJ13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06482 pDONR223 100% 26.1% 22.2% None 223_224ins236;282_283ins562 n/a
2 ccsbBroad304_06482 pLX_304 0% 26.1% 22.2% V5 223_224ins236;282_283ins562 n/a
3 TRCN0000471741 CTCCGCTTACACCTAAGTAACTTA pLX_317 47% 26.1% 22.2% V5 223_224ins236;282_283ins562 n/a
Download CSV