Transcript: Human NM_001172478.2

Homo sapiens ribonucleotide reductase regulatory TP53 inducible subunit M2B (RRM2B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RRM2B (50484)
Length:
4618
CDS:
88..987

Additional Resources:

NCBI RefSeq record:
NM_001172478.2
NBCI Gene record:
RRM2B (50484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046558 GCTGACAGATTACTTGTGGAA pLKO.1 799 CDS 100% 2.640 3.696 N RRM2B n/a
2 TRCN0000046560 GCTAAAGAAGAGAGGTCTTAT pLKO.1 552 CDS 100% 13.200 9.240 N RRM2B n/a
3 TRCN0000342973 GCTAAAGAAGAGAGGTCTTAT pLKO_005 552 CDS 100% 13.200 9.240 N RRM2B n/a
4 TRCN0000042286 CAGCCAGTGATGGAATTGTAA pLKO.1 221 CDS 100% 5.625 3.938 N Rrm2b n/a
5 TRCN0000287222 CAGCCAGTGATGGAATTGTAA pLKO_005 221 CDS 100% 5.625 3.938 N Rrm2b n/a
6 TRCN0000046559 GCGATGGATAGCAGATAGAAA pLKO.1 450 CDS 100% 5.625 3.938 N RRM2B n/a
7 TRCN0000343037 GCGATGGATAGCAGATAGAAA pLKO_005 450 CDS 100% 5.625 3.938 N RRM2B n/a
8 TRCN0000046561 GCAGCCAGTGATGGAATTGTA pLKO.1 220 CDS 100% 5.625 3.375 N RRM2B n/a
9 TRCN0000343036 GCAGCCAGTGATGGAATTGTA pLKO_005 220 CDS 100% 5.625 3.375 N RRM2B n/a
10 TRCN0000307401 CTCACTGGAACAAGCTTAAAT pLKO_005 158 CDS 100% 15.000 10.500 N Rrm2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03142 pDONR223 100% 85.1% 85.1% None 45_46ins156 n/a
2 ccsbBroad304_03142 pLX_304 0% 85.1% 85.1% V5 45_46ins156 n/a
3 TRCN0000479114 CCCACCTGTCTACACTACCCGATC pLX_317 39.8% 85.1% 85.1% V5 45_46ins156 n/a
Download CSV