Transcript: Human NM_001172626.1

Homo sapiens adenosine monophosphate deaminase 1 (AMPD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
AMPD1 (270)
Length:
2414
CDS:
49..2379

Additional Resources:

NCBI RefSeq record:
NM_001172626.1
NBCI Gene record:
AMPD1 (270)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172626.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440165 TAACGAGATGGACGAGTTAAA pLKO_005 966 CDS 100% 13.200 18.480 N AMPD1 n/a
2 TRCN0000050244 CCCGTGCTACAGTACTTGTTT pLKO.1 1939 CDS 100% 5.625 7.875 N AMPD1 n/a
3 TRCN0000050247 GTAAAGTTTCTGGGCGACAAT pLKO.1 2227 CDS 100% 4.950 6.930 N AMPD1 n/a
4 TRCN0000441967 ATATCTCTCATGGCCTAAATT pLKO_005 1907 CDS 100% 15.000 12.000 N AMPD1 n/a
5 TRCN0000050246 CGAACAGACAACCTTCCTGAA pLKO.1 721 CDS 100% 4.050 3.240 N AMPD1 n/a
6 TRCN0000050245 CCCACATTGATGAATACATTT pLKO.1 425 CDS 100% 13.200 9.240 N AMPD1 n/a
7 TRCN0000050243 CCCTTCCAAATACTTGCGGAA pLKO.1 618 CDS 100% 2.160 1.512 N AMPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172626.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.