Transcript: Human NM_001172650.3

Homo sapiens ZNF559-ZNF177 readthrough (ZNF559-ZNF177), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF559-ZNF177 (100529215)
Length:
2597
CDS:
792..1757

Additional Resources:

NCBI RefSeq record:
NM_001172650.3
NBCI Gene record:
ZNF559-ZNF177 (100529215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425758 ACTGTAGATCCTATGAATATT pLKO_005 1958 3UTR 100% 15.000 7.500 Y ZNF177 n/a
2 TRCN0000433873 CAGTGAGTATTTCATTCTTAT pLKO_005 1927 3UTR 100% 13.200 6.600 Y ZNF177 n/a
3 TRCN0000415279 CAATTGCTATGCAGAACATTC pLKO_005 1075 CDS 100% 10.800 5.400 Y ZNF177 n/a
4 TRCN0000012993 GCCTCCTTTCTCACTTTAGAA pLKO.1 1790 3UTR 100% 5.625 2.813 Y ZNF177 n/a
5 TRCN0000012997 GTCTTCCCTTAAGAAACACAT pLKO.1 1199 CDS 100% 4.950 2.475 Y ZNF177 n/a
6 TRCN0000012994 TGTTCCTTCATCCCTTCAGAA pLKO.1 1361 CDS 100% 4.950 2.475 Y ZNF177 n/a
7 TRCN0000012996 CACTAACCTTATAATGCACAA pLKO.1 1703 CDS 100% 4.050 2.025 Y ZNF177 n/a
8 TRCN0000012995 GTCACAGAACTCAGTAACCTT pLKO.1 818 CDS 100% 3.000 1.500 Y ZNF177 n/a
9 TRCN0000242402 GAGAAACCCTATGACTGTAAA pLKO_005 1320 CDS 100% 13.200 6.600 Y Gm14434 n/a
10 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1400 CDS 100% 13.200 6.600 Y Zfp977 n/a
11 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1479 CDS 100% 6.000 3.000 Y Zfp612 n/a
12 TRCN0000015520 CTGGAGAGAAGCCTTATGAAT pLKO.1 1231 CDS 100% 5.625 2.813 Y ZNF625 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01813 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01813 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468093 AAGGCCATTTATGTTGAGAAGCCT pLX_317 39.7% 100% 100% V5 n/a
Download CSV