Transcript: Human NM_001173452.2

Homo sapiens transcription factor CP2 (TFCP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TFCP2 (7024)
Length:
3704
CDS:
714..2219

Additional Resources:

NCBI RefSeq record:
NM_001173452.2
NBCI Gene record:
TFCP2 (7024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001173452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274172 CCCGATGTCTGTGGGTATAAT pLKO_005 1175 CDS 100% 15.000 21.000 N TFCP2 n/a
2 TRCN0000274176 GGCTAATCCAACTCAACTAAA pLKO_005 1205 CDS 100% 13.200 18.480 N TFCP2 n/a
3 TRCN0000274175 TCGTTTACCATGCTATCTATC pLKO_005 1987 CDS 100% 10.800 15.120 N TFCP2 n/a
4 TRCN0000019828 CCGAGTACAAATAGATACCTT pLKO.1 1340 CDS 100% 3.000 4.200 N TFCP2 n/a
5 TRCN0000019826 CCTTCCTATGAGACAACCATA pLKO.1 1512 CDS 100% 4.950 3.960 N TFCP2 n/a
6 TRCN0000274174 CCTTCCTATGAGACAACCATA pLKO_005 1512 CDS 100% 4.950 3.960 N TFCP2 n/a
7 TRCN0000019827 CGAATGCTAGACAATAGGAAA pLKO.1 1005 CDS 100% 4.950 3.960 N TFCP2 n/a
8 TRCN0000019825 GCACTGTATTAGCACAGAGTT pLKO.1 1280 CDS 100% 4.950 3.465 N TFCP2 n/a
9 TRCN0000019824 GCTCTTGTGGTACACACAGAT pLKO.1 2392 3UTR 100% 4.950 3.465 N TFCP2 n/a
10 TRCN0000274225 GCTCTTGTGGTACACACAGAT pLKO_005 2392 3UTR 100% 4.950 3.465 N TFCP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001173452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01661 pDONR223 100% 99.8% 99.8% None 1469_1470insAGC n/a
2 ccsbBroad304_01661 pLX_304 0% 99.8% 99.8% V5 1469_1470insAGC n/a
3 TRCN0000470554 TTTCGACTACCGCGCAAACTAGCT pLX_317 30.2% 99.8% 99.8% V5 1469_1470insAGC n/a
Download CSV