Transcript: Human NM_001173473.1

Homo sapiens acetylserotonin O-methyltransferase like (ASMTL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
ASMTL (8623)
Length:
2064
CDS:
227..1918

Additional Resources:

NCBI RefSeq record:
NM_001173473.1
NBCI Gene record:
ASMTL (8623)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001173473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343886 ACAGAGCAAGGTTACAGTAAC pLKO_005 1103 CDS 100% 10.800 15.120 N ASMTL n/a
2 TRCN0000343885 TGGCATCGGATGGCGAATACT pLKO_005 1146 CDS 100% 5.625 7.875 N ASMTL n/a
3 TRCN0000034537 CGTATGCAGGTGACTGTGTTT pLKO.1 1475 CDS 100% 4.950 6.930 N ASMTL n/a
4 TRCN0000343953 CAAACTGAAGGTGTTCGATTT pLKO_005 967 CDS 100% 10.800 8.640 N ASMTL n/a
5 TRCN0000034535 GCAAACTGAAGGTGTTCGATT pLKO.1 966 CDS 100% 4.950 3.960 N ASMTL n/a
6 TRCN0000034534 CCTCTTTACATACCTGGAGTT pLKO.1 1210 CDS 100% 4.050 3.240 N ASMTL n/a
7 TRCN0000343955 ACCTCACATGGAACCTCTTTA pLKO_005 1197 CDS 100% 13.200 9.240 N ASMTL n/a
8 TRCN0000370453 CTGTTCCAGGATGCGTACTAC pLKO_005 1289 CDS 100% 4.950 3.465 N ASMTL n/a
9 TRCN0000370512 CCTTCAATCTGTCCCGCTTCT pLKO_005 1389 CDS 100% 4.050 2.835 N ASMTL n/a
10 TRCN0000034536 CTACGAGGAAACGAAGGTGAA pLKO.1 484 CDS 100% 4.050 2.835 N ASMTL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001173473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07274 pDONR223 100% 90.3% 90.4% None (many diffs) n/a
2 ccsbBroad304_07274 pLX_304 0% 90.3% 90.4% V5 (many diffs) n/a
3 ccsbBroadEn_07273 pDONR223 100% 90.3% 90.4% None (many diffs) n/a
4 ccsbBroad304_07273 pLX_304 0% 90.3% 90.4% V5 (many diffs) n/a
5 TRCN0000471070 CTCGTCCCCAAGACGGGTGCAAAT pLX_317 24% 90.3% 90.4% V5 (many diffs) n/a
Download CSV