Transcript: Human NM_001173982.2

Homo sapiens carbohydrate sulfotransferase 11 (CHST11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CHST11 (50515)
Length:
5719
CDS:
465..1508

Additional Resources:

NCBI RefSeq record:
NM_001173982.2
NBCI Gene record:
CHST11 (50515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001173982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035914 CGAAGTCTACAAACTCGATTT pLKO.1 1442 CDS 100% 10.800 15.120 N CHST11 n/a
2 TRCN0000432550 GAAATCAACCACCGCTTGAAA pLKO_005 960 CDS 100% 5.625 7.875 N CHST11 n/a
3 TRCN0000035915 CGATGTCAAATTCGAGGAGTT pLKO.1 1148 CDS 100% 4.050 5.670 N CHST11 n/a
4 TRCN0000424427 CTGGAAGAGGATTCTAATTAC pLKO_005 1293 CDS 100% 13.200 9.240 N CHST11 n/a
5 TRCN0000035917 CCTATGCAAAGTCTACGAGAA pLKO.1 1357 CDS 100% 4.050 2.835 N CHST11 n/a
6 TRCN0000035916 GCAGGAACTCTACAACCCAAT pLKO.1 629 CDS 100% 4.050 2.835 N CHST11 n/a
7 TRCN0000035918 CTGGTCATCTTCTATTTCCAA pLKO.1 546 CDS 100% 3.000 2.100 N CHST11 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5187 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001173982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470969 AGCATCCGTTTTTAGTTGCCCGCT pLX_317 34.5% 98.4% 98.2% V5 103_104insGTATGTTGCACCCAG;1023A>C n/a
2 ccsbBroadEn_08177 pDONR223 100% 98.3% 97.7% None 103_104insGTATGTTGCACCCAG;1023A>N;1038G>N n/a
3 ccsbBroad304_08177 pLX_304 0% 98.3% 97.7% V5 103_104insGTATGTTGCACCCAG;1023A>N;1038G>N n/a
Download CSV