Transcript: Human NM_001174095.2

Homo sapiens zinc finger E-box binding homeobox 1 (ZEB1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
ZEB1 (6935)
Length:
5733
CDS:
20..3193

Additional Resources:

NCBI RefSeq record:
NM_001174095.2
NBCI Gene record:
ZEB1 (6935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001174095.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364631 CCTACCACTGGATGTAGTAAA pLKO_005 1675 CDS 100% 13.200 18.480 N ZEB1 n/a
2 TRCN0000017564 GCTGCCAATAAGCAAACGATT pLKO.1 2306 CDS 100% 4.950 6.930 N ZEB1 n/a
3 TRCN0000369267 TGTCTCCCATAAGTATCAATT pLKO_005 1023 CDS 100% 13.200 10.560 N ZEB1 n/a
4 TRCN0000364557 GGTTAAAGGAAGCTGATTAAT pLKO_005 3510 3UTR 100% 15.000 10.500 N ZEB1 n/a
5 TRCN0000369265 GTCTGGGTGTAATCGTAAATT pLKO_005 517 CDS 100% 15.000 10.500 N ZEB1 n/a
6 TRCN0000364556 TATTGTGATAGAGGCTATAAA pLKO_005 338 CDS 100% 15.000 10.500 N ZEB1 n/a
7 TRCN0000017565 CCTCTCTGAAAGAACACATTA pLKO.1 366 CDS 100% 13.200 9.240 N ZEB1 n/a
8 TRCN0000369266 CTGAACCTCAGACCTAGTAAT pLKO_005 3401 3UTR 100% 13.200 9.240 N ZEB1 n/a
9 TRCN0000017563 GCAACAATACAAGAGGTTAAA pLKO.1 3496 3UTR 100% 13.200 9.240 N ZEB1 n/a
10 TRCN0000017567 GCTGTTGTTCTGCCAACAGTT pLKO.1 995 CDS 100% 0.495 0.347 N ZEB1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3363 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001174095.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13965 pDONR223 100% 93.9% 62.6% None 57_58ins204;2117_2118insA n/a
2 ccsbBroad304_13965 pLX_304 0% 93.9% 62.6% V5 (not translated due to prior stop codon) 57_58ins204;2117_2118insA n/a
3 TRCN0000477158 CCCGCTCATGGGATCTCCAACAGT pLX_317 10.6% 93.9% 62.6% V5 (not translated due to prior stop codon) 57_58ins204;2117_2118insA n/a
Download CSV