Transcript: Human NM_001174117.2

Homo sapiens Dmx like 2 (DMXL2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
DMXL2 (23312)
Length:
8691
CDS:
227..7429

Additional Resources:

NCBI RefSeq record:
NM_001174117.2
NBCI Gene record:
DMXL2 (23312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001174117.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144796 GCCTTGCATGAGATATGTAAT pLKO.1 4565 CDS 100% 13.200 18.480 N DMXL2 n/a
2 TRCN0000338675 GCCTTGCATGAGATATGTAAT pLKO_005 4565 CDS 100% 13.200 18.480 N DMXL2 n/a
3 TRCN0000141435 CGCTGCTAACTGAATGGAATA pLKO.1 1716 CDS 100% 10.800 15.120 N DMXL2 n/a
4 TRCN0000338674 CGCTGCTAACTGAATGGAATA pLKO_005 1716 CDS 100% 10.800 15.120 N DMXL2 n/a
5 TRCN0000145518 GCCCGTTTATATGAATCTGAA pLKO.1 3581 CDS 100% 4.950 3.960 N DMXL2 n/a
6 TRCN0000253306 CATGCTAAGCAGTCCATATTT pLKO_005 7268 CDS 100% 15.000 10.500 N Dmxl2 n/a
7 TRCN0000142512 GCCACAAGTGACTTTGCATTT pLKO.1 6878 CDS 100% 10.800 7.560 N DMXL2 n/a
8 TRCN0000338742 GCCACAAGTGACTTTGCATTT pLKO_005 6878 CDS 100% 10.800 7.560 N DMXL2 n/a
9 TRCN0000144307 CCATTAGGTATTGCTGTGATT pLKO.1 5939 CDS 100% 4.950 3.465 N DMXL2 n/a
10 TRCN0000338676 CCATTAGGTATTGCTGTGATT pLKO_005 5939 CDS 100% 4.950 3.465 N DMXL2 n/a
11 TRCN0000140323 CCAGTTACTGTCTAGGCACAT pLKO.1 2526 CDS 100% 4.050 2.835 N DMXL2 n/a
12 TRCN0000141277 CTACAGTCATCACTAGGCAAT pLKO.1 7474 3UTR 100% 4.050 2.835 N DMXL2 n/a
13 TRCN0000253309 CATGGTTATTGCCCGTTTATT pLKO_005 3571 CDS 100% 15.000 10.500 N Dmxl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001174117.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.