Transcript: Human NM_001174118.2

Homo sapiens mex-3 RNA binding family member D (MEX3D), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
MEX3D (399664)
Length:
2927
CDS:
268..2268

Additional Resources:

NCBI RefSeq record:
NM_001174118.2
NBCI Gene record:
MEX3D (399664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001174118.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016393 CAGCCCTTCAACGACAGTATT pLKO.1 2246 CDS 100% 13.200 18.480 N MEX3D n/a
2 TRCN0000235935 GTGATCGGCAGCCGCAAGAAA pLKO_005 772 CDS 100% 1.875 2.625 N MEX3D n/a
3 TRCN0000235937 GAGTGGTCAGGTTACAATAAA pLKO_005 2267 CDS 100% 15.000 10.500 N MEX3D n/a
4 TRCN0000235933 GGCCGAACACTTCTCCATCAT pLKO_005 996 CDS 100% 4.950 3.465 N MEX3D n/a
5 TRCN0000235934 CTTCGGCTTCGACTTCGACTT pLKO_005 1623 CDS 100% 4.050 2.835 N MEX3D n/a
6 TRCN0000016395 CGGCTTCGACTTCGACTTCCT pLKO.1 1626 CDS 100% 0.880 0.616 N MEX3D n/a
7 TRCN0000016397 CGACAGCGACTTCCACGCCAA pLKO.1 1317 CDS 100% 0.000 0.000 N MEX3D n/a
8 TRCN0000145938 CGACAGCGACTTCCACGCCAA pLKO.1 1317 CDS 100% 0.000 0.000 N MEX3D n/a
9 TRCN0000016396 GCGCGACAAGGAGCCGGTGTT pLKO.1 1200 CDS 100% 0.000 0.000 N MEX3D n/a
10 TRCN0000016394 CAAGACAAACACCTACATCAA pLKO.1 888 CDS 100% 4.950 2.970 N MEX3D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001174118.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470439 CCTGACGACTCTCAATGGACTAGC pLX_317 22.7% 73.1% 72.9% V5 1_534del;554_555delTGinsAC;1601C>T n/a
Download CSV