Transcript: Mouse NM_001177552.1

Mus musculus bifunctional apoptosis regulator (Bfar), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Bfar (67118)
Length:
2635
CDS:
296..1273

Additional Resources:

NCBI RefSeq record:
NM_001177552.1
NBCI Gene record:
Bfar (67118)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040565 GCTCTGTACTTCAACCCAATT pLKO.1 1196 CDS 100% 10.800 6.480 N Bfar n/a
2 TRCN0000323982 GCTCTGTACTTCAACCCAATT pLKO_005 1196 CDS 100% 10.800 6.480 N Bfar n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03265 pDONR223 100% 61.7% 65.3% None (many diffs) n/a
2 ccsbBroad304_03265 pLX_304 0% 61.7% 65.3% V5 (many diffs) n/a
3 TRCN0000469673 GTCCCACACCTGTTTACAAGTGCG pLX_317 31.3% 61.7% 65.3% V5 (many diffs) n/a
Download CSV