Transcript: Mouse NM_001177621.1

Mus musculus solute carrier family 5 (sodium-dependent vitamin transporter), member 6 (Slc5a6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Slc5a6 (330064)
Length:
3455
CDS:
761..2665

Additional Resources:

NCBI RefSeq record:
NM_001177621.1
NBCI Gene record:
Slc5a6 (330064)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417750 CAAAGGACCTTGAGCTTTAAA pLKO_005 2784 3UTR 100% 15.000 21.000 N Slc5a6 n/a
2 TRCN0000070331 CCTTTGCCTATGGGCTAGTTT pLKO.1 1965 CDS 100% 5.625 7.875 N LOC434043 n/a
3 TRCN0000070304 GCGTCATACTTTCTGGACTTT pLKO.1 1513 CDS 100% 4.950 6.930 N Slc5a6 n/a
4 TRCN0000070305 CCAGCTGAGATCTTCCGATTT pLKO.1 1022 CDS 100% 10.800 8.640 N Slc5a6 n/a
5 TRCN0000070307 CCTAGGAATTGTCTGCAACAT pLKO.1 1303 CDS 100% 4.950 3.960 N Slc5a6 n/a
6 TRCN0000070330 GCCTGGGAATGGCCTATATTT pLKO.1 1986 CDS 100% 15.000 10.500 N LOC434043 n/a
7 TRCN0000428990 CGGCATTGGGAGCATAGTAAG pLKO_005 2167 CDS 100% 10.800 7.560 N Slc5a6 n/a
8 TRCN0000070303 CCTCTGGTGATTCCTTCACTA pLKO.1 3049 3UTR 100% 4.950 3.465 N Slc5a6 n/a
9 TRCN0000070329 CCTGACCAGTTAGTCCTCTAT pLKO.1 1754 CDS 100% 4.950 3.465 N LOC434043 n/a
10 TRCN0000070306 CTCCGCTTCAATAAAGCAGTT pLKO.1 1160 CDS 100% 4.050 2.835 N Slc5a6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.