Transcript: Human NM_001177637.2

Homo sapiens dystroglycan 1 (DAG1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
DAG1 (1605)
Length:
5663
CDS:
539..3226

Additional Resources:

NCBI RefSeq record:
NM_001177637.2
NBCI Gene record:
DAG1 (1605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001177637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056190 CGTGGGCAAACACGAGTATTT pLKO.1 2245 CDS 100% 13.200 18.480 N DAG1 n/a
2 TRCN0000349743 TTGTCGGCACCTACAGTTTAT pLKO_005 2674 CDS 100% 13.200 18.480 N DAG1 n/a
3 TRCN0000056191 CGAGTGACCATTCCAACAGAT pLKO.1 773 CDS 100% 4.950 6.930 N DAG1 n/a
4 TRCN0000312639 ACGTGGGCAAACACGAGTATT pLKO_005 2244 CDS 100% 13.200 9.240 N DAG1 n/a
5 TRCN0000377378 TTACGTTTAATCTGCTGTTTA pLKO_005 3717 3UTR 100% 13.200 9.240 N DAG1 n/a
6 TRCN0000377379 CACCAAGAAGCCACGAGTATC pLKO_005 1807 CDS 100% 10.800 7.560 N DAG1 n/a
7 TRCN0000056192 GCAAGGTTCAAGGCCAAGTTT pLKO.1 2354 CDS 100% 5.625 3.938 N DAG1 n/a
8 TRCN0000056189 CGGATGAACCTGTGACTGTTT pLKO.1 1089 CDS 100% 4.950 3.465 N DAG1 n/a
9 TRCN0000056188 CGGTGGTGAATAACAGACTAT pLKO.1 1224 CDS 100% 4.950 3.465 N DAG1 n/a
10 TRCN0000327784 CGGTGGTGAATAACAGACTAT pLKO_005 1224 CDS 100% 4.950 3.465 N DAG1 n/a
11 TRCN0000312640 ACTTTCAGAAGTTAAGGTTAA pLKO_005 3692 3UTR 100% 10.800 6.480 N DAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.