Transcript: Mouse NM_001177732.1

Mus musculus phospholipase C, eta 1 (Plch1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Plch1 (269437)
Length:
6294
CDS:
1..3012

Additional Resources:

NCBI RefSeq record:
NM_001177732.1
NBCI Gene record:
Plch1 (269437)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419491 GCCCTGCCTGTGACGTATTTA pLKO_005 851 CDS 100% 15.000 21.000 N Plch1 n/a
2 TRCN0000419148 CATGCATTTGTATATAGATTC pLKO_005 5220 3UTR 100% 10.800 15.120 N Plch1 n/a
3 TRCN0000097100 GCAGCGAAGATAAACCCGAAA pLKO.1 5034 3UTR 100% 4.050 5.670 N Plch1 n/a
4 TRCN0000097103 CGCATTATGTTCGGAAGCGAT pLKO.1 2717 CDS 100% 2.640 3.696 N Plch1 n/a
5 TRCN0000097102 GCGTTACTCAAGGCTACACAT pLKO.1 1549 CDS 100% 4.950 3.960 N Plch1 n/a
6 TRCN0000428296 ACTCTAGAAGATGTTAGATTT pLKO_005 5113 3UTR 100% 13.200 9.240 N Plch1 n/a
7 TRCN0000433540 GATGCTTCTCCTGGTCAATTT pLKO_005 3932 3UTR 100% 13.200 9.240 N Plch1 n/a
8 TRCN0000425627 GTGGTTACATTGCCCTTTATG pLKO_005 5562 3UTR 100% 13.200 9.240 N Plch1 n/a
9 TRCN0000436392 TAACCATCAATGAGATCTTTG pLKO_005 2561 CDS 100% 10.800 7.560 N Plch1 n/a
10 TRCN0000097101 CGTGACTTTAACAAATGAGAA pLKO.1 3568 3UTR 100% 4.950 3.465 N Plch1 n/a
11 TRCN0000097099 CCGACTTTAATCCCAGTAGAA pLKO.1 5866 3UTR 100% 4.950 2.970 N Plch1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.