Transcript: Mouse NM_001177843.1

Mus musculus FERM domain containing 4A (Frmd4a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Frmd4a (209630)
Length:
6780
CDS:
619..3681

Additional Resources:

NCBI RefSeq record:
NM_001177843.1
NBCI Gene record:
Frmd4a (209630)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177843.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437520 CCATTTGGGCGATGGCTATTA pLKO_005 1490 CDS 100% 13.200 18.480 N Frmd4a n/a
2 TRCN0000216739 GTTGACAGTGAAGTGGTATTT pLKO.1 970 CDS 100% 13.200 18.480 N Frmd4a n/a
3 TRCN0000174607 GTTCACTATTATGCAGTGAAA pLKO.1 1225 CDS 100% 0.495 0.396 N Frmd4a n/a
4 TRCN0000427088 GTGAAGCCAAGGAAGATATTT pLKO_005 1318 CDS 100% 15.000 10.500 N Frmd4a n/a
5 TRCN0000446206 AGCGTCAAAGCGCAGTTTAAG pLKO_005 3148 CDS 100% 13.200 9.240 N Frmd4a n/a
6 TRCN0000431389 ATATCAGTTTACACCTGAAAT pLKO_005 4206 3UTR 100% 13.200 9.240 N Frmd4a n/a
7 TRCN0000144135 CCAGTATGACTACCATGATAA pLKO.1 1296 CDS 100% 13.200 9.240 N FRMD4A n/a
8 TRCN0000175234 CCTGTAGAAGAGAACAAGAAA pLKO.1 4096 3UTR 100% 5.625 3.938 N Frmd4a n/a
9 TRCN0000174524 CTTCTGTGTCAGATTCTACAT pLKO.1 861 CDS 100% 4.950 3.465 N Frmd4a n/a
10 TRCN0000193973 GAGAATTGGAACAGCCTTCAA pLKO.1 1893 CDS 100% 4.950 3.465 N Frmd4a n/a
11 TRCN0000176359 CCCACTATGTTCATTCCACAA pLKO.1 2618 CDS 100% 4.050 2.835 N Frmd4a n/a
12 TRCN0000141074 CGACTATGACAAGTCACCCAT pLKO.1 2373 CDS 100% 2.640 1.848 N FRMD4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177843.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.